ern1

Ensembl ID:
ENSDARG00000013997
ZFIN ID:
ZDB-GENE-050522-431
Description:
endoplasmic reticulum to nucleus signaling 1 [Source:RefSeq peptide;Acc:NP_001018366]
Human Orthologue:
ERN1
Human Description:
endoplasmic reticulum to nucleus signaling 1 [Source:HGNC Symbol;Acc:3449]
Mouse Orthologue:
Ern1
Mouse Description:
endoplasmic reticulum (ER) to nucleus signalling 1 Gene [Source:MGI Symbol;Acc:MGI:1930134]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40179 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014182 Nonsense 283 1031 8 22
ENSDART00000144638 Nonsense 283 751 8 22
Genomic Location (Zv9):
Chromosome 3 (position 56313823)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55190145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGGTGGGCCGCATCACACAGTGGAAGTATCCATTTCCTCGAGAAAAG[A/T]AAACCAAAGATAAACTGTTGTAAGTAGCCCCTTTAACTCCTTTTATTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link