anxa13

Ensembl ID:
ENSDARG00000013976
ZFIN ID:
ZDB-GENE-010406-1
Description:
annexin A13 [Source:RefSeq peptide;Acc:NP_571849]
Human Orthologue:
ANXA13
Human Description:
annexin A13 [Source:HGNC Symbol;Acc:536]
Mouse Orthologue:
Anxa13
Mouse Description:
annexin A13 Gene [Source:MGI Symbol;Acc:MGI:1917037]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3289 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013294 Essential Splice Site 62 316 3 11
ENSDART00000122608 Essential Splice Site 62 291 3 12
Genomic Location:
Chromosome 24 (position 6456746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCAGAGAATGGAGATCAAGCAAGCCTACTTTGAGAAATATGATGACG[T/C]GAGTATTCGGAAAAGCAGTTAATGAAAATAWACWGTGGAGATYAAAATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7a6gm0bx