gfra1b

Ensembl ID:
ENSDARG00000013975
ZFIN ID:
ZDB-GENE-010226-3
Description:
gdnf family receptor alpha 1b [Source:RefSeq peptide;Acc:NP_571806]
Human Orthologue:
GFRA1
Human Description:
GDNF family receptor alpha 1 [Source:HGNC Symbol;Acc:4243]
Mouse Orthologue:
Gfra1
Mouse Description:
glial cell line derived neurotrophic factor family receptor alpha 1 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31882 Essential Splice Site Available for shipment Available now
sa22124 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005456 Essential Splice Site 269 481 5 9
ENSDART00000105709 Essential Splice Site 269 481 5 9
Genomic Location (Zv9):
Chromosome 12 (position 31373567)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29686672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAGATGTACTTTATGGAATCGTGTTCATTCCTGCTTAATTTTTTTGC[A/T]GATCTCGTTTAGCTGACTTCCTCACTAACTGTCAACCTGAGGCCCGCTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005456 Nonsense 414 481 7 9
ENSDART00000105709 Nonsense 414 481 7 9
Genomic Location (Zv9):
Chromosome 12 (position 31383032)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 29696137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCACCAATGACCTCGACAGCAATGCAGACCATCTCTACAGCTTCTGT[G/T]GAAGCCTGCAGGTACAGAAGTTAGACAAGCATCCTAAAGTTTTCCATCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link