pex3

Ensembl ID:
ENSDARG00000013973
ZFIN ID:
ZDB-GENE-040426-979
Description:
peroxisomal biogenesis factor 3 [Source:RefSeq peptide;Acc:NP_956522]
Human Orthologue:
PEX3
Human Description:
peroxisomal biogenesis factor 3 [Source:HGNC Symbol;Acc:8858]
Mouse Orthologue:
Pex3
Mouse Description:
peroxisomal biogenesis factor 3 Gene [Source:MGI Symbol;Acc:MGI:1929646]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17571 Nonsense Available for shipment Available now
sa11684 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012826 Nonsense 36 364 2 12
Genomic Location (Zv9):
Chromosome 20 (position 37785724)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37858237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWAASTTTTTATTTGCAGGTGTTTATCTGCTTGGTAAATATGCACAGAGA[A/T]AAATTCMGGAGATGCAGGAGCRAGAGGCAGCTGAATACATTGCTCAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012826 Essential Splice Site 337 364 11 12
Genomic Location (Zv9):
Chromosome 20 (position 37793038)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37865551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGACAGATTCATTCAATATGCAGCGAAATTCCAAGCCACTTTGTTCAG[G/A]TGAGCACCTTCATATAAACYGACTCTTTTTCATTTAAATCATATATAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link