psap

Ensembl ID:
ENSDARG00000013968
ZFIN ID:
ZDB-GENE-020108-1
Description:
prosaposin [Source:RefSeq peptide;Acc:NP_571958]
Human Orthologues:
PSAP, PSAPL1
Human Descriptions:
prosaposin [Source:HGNC Symbol;Acc:9498]
prosaposin-like 1 (gene/pseudogene) [Source:HGNC Symbol;Acc:33131]
Mouse Orthologues:
Psap, Psapl1
Mouse Descriptions:
prosaposin Gene [Source:MGI Symbol;Acc:MGI:97783]
prosaposin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1924193]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18635 Nonsense Available for shipment Available now
sa42131 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045069 Nonsense 63 521 3 16
ENSDART00000056295 Nonsense 63 520 3 14
ENSDART00000130379 Nonsense 63 521 3 17
Genomic Location (Zv9):
Chromosome 13 (position 4690450)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4885228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAKTGTATAAAACCCTTCCTTTATTGCAGAAAACTGTGCCATGTGATY[T/A]GTGCAAAGAGGTGTTGGTGGTAGTGGAGCAGCTGCTGAAGGACAAYGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045069 Nonsense 132 521 7 16
ENSDART00000056295 Nonsense 133 520 5 14
ENSDART00000130379 Nonsense 132 521 7 17
Genomic Location (Zv9):
Chromosome 13 (position 4693254)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4888032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTTGTATTTCATCTTGCAGGATGACCCTGGTGTAGTGTGTGGCGCTT[T/A]GGGTCTGTGCGTATCCCAGCAGGCAGCTCTGGCTAAAGCTCAGCTCACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link