psma6b

Ensembl ID:
ENSDARG00000013966
ZFIN ID:
ZDB-GENE-040718-329
Description:
proteasome subunit alpha type-6 [Source:RefSeq peptide;Acc:NP_001002589]
Human Orthologue:
PSMA6
Human Description:
proteasome (prosome, macropain) subunit, alpha type, 6 [Source:HGNC Symbol;Acc:9535]
Mouse Orthologue:
Psma6
Mouse Description:
proteasome (prosome, macropain) subunit, alpha type 6 Gene [Source:MGI Symbol;Acc:MGI:1347006]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32281 Nonsense Available for shipment Available now
sa12634 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012859 Nonsense 60 246 3 7
Genomic Location (Zv9):
Chromosome 20 (position 16942600)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17002553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATAGAAATTTGTACTTTTTTTTTTGCACATGCTTTTCCAGGACAAGT[T/A]GCTGGATTCATCAACCGTCACGCACTTATTCAGAATTACAGAGAACATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012859 Essential Splice Site 137 246 5 7
Genomic Location (Zv9):
Chromosome 20 (position 16937668)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 16997621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCCAGTWTCTTGTGTGAGTGTCTGATTTGTGTTTGTGTTTGTCTTCA[G/T]GCATGATTGTGATTGGTCTAGATGAGGAGCTCGGCCCGCAAGTGTATAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Psoriasis: Genome-wide association analysis identifies three psoriasis susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link