cul2

Ensembl ID:
ENSDARG00000013965
ZFIN ID:
ZDB-GENE-030131-8032
Human Orthologue:
CUL2
Human Description:
cullin 2 [Source:HGNC Symbol;Acc:2552]
Mouse Orthologue:
Cul2
Mouse Description:
cullin 2 Gene [Source:MGI Symbol;Acc:MGI:1918995]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25203 Nonsense Mutation detected in F1 DNA During 2014
sa24431 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013257 Nonsense 272 764 10 22
ENSDART00000138432 Nonsense 253 745 9 21
ENSDART00000140125 None None 93 None 4
Genomic Location:
Chromosome 24 (position 2331934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAGGTTTTGGGCAGGTTGAAAGATGAGGAGGTGAGATGTCGGAAGTA[T/A]CTTCACCCCAGCTCTTACTCCAAAGTCATCCATGAATGTCAGCAGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013257 Nonsense 619 764 19 22
ENSDART00000138432 Nonsense 600 745 18 21
ENSDART00000140125 None None 93 None 4
Genomic Location:
Chromosome 24 (position 2323572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTTCTGCTGGCGTTCAACAACAGCGAGACTGTGAGCTATAAAGAACTG[C/T]AGGACAGCACACAGATGAACGAGAAAGAGCTCCAGAAGACCATCAAATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4c8civxi