cul2

Ensembl ID:
ENSDARG00000013965
ZFIN ID:
ZDB-GENE-030131-8032
Human Orthologue:
CUL2
Human Description:
cullin 2 [Source:HGNC Symbol;Acc:2552]
Mouse Orthologue:
Cul2
Mouse Description:
cullin 2 Gene [Source:MGI Symbol;Acc:MGI:1918995]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25203 Nonsense Mutation detected in F1 DNA During 2015
sa24431 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa25203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013257 Nonsense 272 764 10 22
ENSDART00000138432 Nonsense 253 745 9 21
ENSDART00000140125   None 93 None 4
Genomic Location:
Chromosome 24 (position 2331934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAGGTTTTGGGCAGGTTGAAAGATGAGGAGGTGAGATGTCGGAAGTA[T/A]CTTCACCCCAGCTCTTACTCCAAAGTCATCCATGAATGTCAGCAGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013257 Nonsense 619 764 19 22
ENSDART00000138432 Nonsense 600 745 18 21
ENSDART00000140125   None 93 None 4
Genomic Location:
Chromosome 24 (position 2323572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTTCTGCTGGCGTTCAACAACAGCGAGACTGTGAGCTATAAAGAACTG[C/T]AGGACAGCACACAGATGAACGAGAAAGAGCTCCAGAAGACCATCAAATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4c8civxi