ivns1abpb

Ensembl ID:
ENSDARG00000013946
ZFIN ID:
ZDB-GENE-030131-6266
Description:
Influenza virus NS1A-binding protein homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVQ8]
Human Orthologue:
IVNS1ABP
Human Description:
influenza virus NS1A binding protein [Source:HGNC Symbol;Acc:16951]
Mouse Orthologue:
Ivns1abp
Mouse Description:
influenza virus NS1A binding protein Gene [Source:MGI Symbol;Acc:MGI:2152389]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6837 Nonsense Mutation detected in F1 DNA During 2017
sa2027 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa6837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020136 Nonsense 90 640 4 15
Genomic Location (Zv9):
Chromosome 2 (position 22846027)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23731468
KASP Assay ID:
554-4202.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAAATTCGATGACCTCAACCCTGATGCTRTGGAGGTCTTGCTCAACTA[T/A]GCCTACACAGCCCAGYACATGCATTTTTATTCCATTTAAATTATACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2027
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020136 Essential Splice Site 95 640 4 15
Genomic Location (Zv9):
Chromosome 2 (position 22846011)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23731452
KASP Assay ID:
554-2431.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACCCTGATGCTRTGGAGGTCTTGCTCAACTATGCCTACACAGCCCAG[T/C]ACATGCATTTTTATTCCATTTAAATTATACATTACATGATGATCTTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link