psmb3

Ensembl ID:
ENSDARG00000013938
ZFIN ID:
ZDB-GENE-040426-2682
Description:
proteasome subunit beta type-3 [Source:RefSeq peptide;Acc:NP_001123295]
Human Orthologue:
PSMB3
Human Description:
proteasome (prosome, macropain) subunit, beta type, 3 [Source:HGNC Symbol;Acc:9540]
Mouse Orthologues:
Gm4950, Gm5356, Psmb3
Mouse Descriptions:
predicted pseudogene 4950 Pseudogene [Source:MGI Symbol;Acc:MGI:3649015]
predicted pseudogene 5356 Pseudogene [Source:MGI Symbol;Acc:MGI:3643649]
proteasome (prosome, macropain) subunit, beta type 3 Gene [Source:MGI Symbol;Acc:MGI:1347014]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30871 Nonsense Mutation detected in F1 DNA During 2017
sa40661 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022499 Nonsense 74 205 3 6
ENSDART00000022499 Nonsense 74 205 3 6
Genomic Location (Zv9):
Chromosome 6 (position 16408660)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16363918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTCCTTTATTCTAGATCTCAAAGGCTGAAGTTCCGCCTGAACCTGTA[T/A]GAGCTGAAAGAAGGTCGTCAGATCAAGCCAAGGACCTTCATGAGCATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022499 Nonsense 74 205 3 6
ENSDART00000022499 Nonsense 74 205 3 6
Genomic Location (Zv9):
Chromosome 6 (position 16408660)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16363918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTCCTTTATTCTAGATCTCAAAGGCTGAAGTTCCGCCTGAACCTGTA[T/A]GAGCTGAAAGAAGGTCGTCAGATCAAGCCAAGGACCTTCATGAGCATGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link