lect1

Ensembl ID:
ENSDARG00000013930
ZFIN ID:
ZDB-GENE-010713-1
Description:
Chondromodulin-1Chondrosurfactant protein [Source:UniProtKB/Swiss-Prot;Acc:P58239]
Human Orthologue:
LECT1
Human Description:
leukocyte cell derived chemotaxin 1 [Source:HGNC Symbol;Acc:17005]
Mouse Orthologue:
Lect1
Mouse Description:
leukocyte cell derived chemotaxin 1 Gene [Source:MGI Symbol;Acc:MGI:1341171]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27501 Essential Splice Site, Missense, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site, Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010210 Missense, Splice Site 214 287 7 7
ENSDART00000135064 Essential Splice Site 214 286 None 7

The following transcripts of ENSDARG00000013930 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 55768241)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54203719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTGATGGACAATAATAGCTGACCGCTCTGTCTGGTGTCTGTCTCAGC[A/C]GCAGAATCAGGGTTCGGAGGGCACCATGGTGTTCGACCCCATGCTGGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link