frya

Ensembl ID:
ENSDARG00000013921
ZFIN ID:
ZDB-GENE-060510-4
Human Orthologue:
FRY
Human Description:
furry homolog (Drosophila) [Source:HGNC Symbol;Acc:20367]
Mouse Orthologue:
Fry
Mouse Description:
furry homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443895]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22679 Essential Splice Site Available for shipment Available now
sa13092 Essential Splice Site Available for shipment Available now
sa12657 Essential Splice Site Available for shipment Available now
sa35928 Nonsense Mutation detected in F1 DNA During 2016
sa7409 Missense Mutation detected in F1 DNA During 2016
sa22680 Nonsense Available for shipment Available now
sa15169 Essential Splice Site Available for shipment Available now
sa22681 Essential Splice Site Available for shipment Available now
sa39060 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14402 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 236 3024 8 62
Genomic Location (Zv9):
Chromosome 15 (position 31078646)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31974298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGTGCTTCATCCCACACTCTTATTTTATTTGTTGTTTTCTTTTTGT[A/T]GATTTCCTGCTGTTAAAAAGAGGTTCACGAGTGAGTTGAAGGAGCTTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 390 3024 11 62
ENSDART00000045921 Essential Splice Site 390 3024 11 62
Genomic Location (Zv9):
Chromosome 15 (position 31079583)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31975235
KASP Assay ID:
2260-8723.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTYAATAGATGGCATGTCTTCCTCAACAACTGCCTCTCCAATCTAAAGG[T/C]ATGTGGTTTCACTGGTTATCTTTATTCATATGTGATTCTWCAAGAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 390 3024 11 62
ENSDART00000045921 Essential Splice Site 390 3024 11 62
Genomic Location (Zv9):
Chromosome 15 (position 31079583)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31975235
KASP Assay ID:
2260-8723.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTYAATAGATGGCATGTCTTCCTCAACAACTGCCTCTCCAATCTAAAGG[T/C]ATGTGGTTTCACTGGTTATCTTTATTCATATGTGATTCTWCAAGAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Nonsense 395 3024 12 62
Genomic Location (Zv9):
Chromosome 15 (position 31079680)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31975332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAAATGTGATAGCATACATTTGATCTGTTGTTACAGAGTAAGGACCCT[A/T]AAATGGCACGGGTAGCGCTAGAGTCCCTCTACAGACTTTTATGGGTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Missense 873 3024 21 62
Genomic Location (Zv9):
Chromosome 15 (position 31095265)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31990917
KASP Assay ID:
554-4177.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGACAGGAGTACCTGCCTAAACACTGTCCCACAGCGCTCAGCTATGCC[T/A]GGCCCTACGCCTTCACCCGTCTGCAGCTCCTCATGCCTTTACTTGAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Nonsense 933 3024 22 62
Genomic Location (Zv9):
Chromosome 15 (position 31098433)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31994085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGTGTTTTGGTGTGGCCAAACCAAGCATCATGAGCCCGGGTCATCTT[C/T]GAGCATCCACCCCTGAGATCATCACTCCCAGCCCAGACAGCAACAGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 1045 3024 26 62
Genomic Location (Zv9):
Chromosome 15 (position 31102213)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31997865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAACTCACAGCCTGAGAARCAAGACATAACTCCGGTCTCTGTGTCTCTC[A/T]GCACAAATGGAGCCCTGGAACGYRATACACTGGCCCTGGGCGCKCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 1527 3024 34 62
Genomic Location (Zv9):
Chromosome 15 (position 31113171)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32008823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTCTACCGATTTTCAGCCACAAGTAAAATTGTCACCACCTCTTCTGG[T/A]ATGCAAAGCCTTACTCAACATAAAGAAAAGTTGTGTGCGCGTTTAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 1669 3024 38 62
Genomic Location (Zv9):
Chromosome 15 (position 31119018)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32014670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGACTGGGCTCTTCATCTCCCTCTGCTGCTCCATGCCTGTTTTCTTG[G/A]TCAGTTGTGTTTTCAACACAATTTAGGCCATTTTTTCAGGGATTAGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Nonsense 2346 3024 49 62
Genomic Location (Zv9):
Chromosome 15 (position 31135366)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32031018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACGCCGGTGATTGGTCGACGGTATGATGAGCTTCACGGTTCTCCAAGA[C/T]AAGATGGKAAGAATCAAGGAGTGGTTACGGTGACACGCAGYACCTCCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link