frya

Ensembl ID:
ENSDARG00000013921
ZFIN ID:
ZDB-GENE-060510-4
Human Orthologue:
FRY
Human Description:
furry homolog (Drosophila) [Source:HGNC Symbol;Acc:20367]
Mouse Orthologue:
Fry
Mouse Description:
furry homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443895]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22679 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13092 Essential Splice Site Available for shipment Available now
sa12657 Essential Splice Site Available for shipment Available now
sa7409 Missense Mutation detected in F1 DNA During 2014
sa22680 Nonsense Mutation detected in F1 DNA During 2014
sa15169 Essential Splice Site Available for shipment Available now
sa22681 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14402 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 236 3024 8 62
Genomic Location:
Chromosome 15 (position 31078646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGTGCTTCATCCCACACTCTTATTTTATTTGTTGTTTTCTTTTTGT[A/T]GATTTCCTGCTGTTAAAAAGAGGTTCACGAGTGAGTTGAAGGAGCTTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 390 3024 11 62
ENSDART00000045921 Essential Splice Site 390 3024 11 62
Genomic Location:
Chromosome 15 (position 31079583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTYAATAGATGGCATGTCTTCCTCAACAACTGCCTCTCCAATCTAAAGG[T/C]ATGTGGTTTCACTGGTTATCTTTATTCATATGTGATTCTWCAAGAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 390 3024 11 62
ENSDART00000045921 Essential Splice Site 390 3024 11 62
Genomic Location:
Chromosome 15 (position 31079583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTYAATAGATGGCATGTCTTCCTCAACAACTGCCTCTCCAATCTAAAGG[T/C]ATGTGGTTTCACTGGTTATCTTTATTCATATGTGATTCTWCAAGAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Missense 873 3024 21 62
Genomic Location:
Chromosome 15 (position 31095265)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGACAGGAGTACCTGCCTAAACACTGTCCCACAGCGCTCAGCTATGCC[T/A]GGCCCTACGCCTTCACCCGTCTGCAGCTCCTCATGCCTTTACTTGAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Nonsense 933 3024 22 62
Genomic Location:
Chromosome 15 (position 31098433)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGTGTTTTGGTGTGGCCAAACCAAGCATCATGAGCCCGGGTCATCTT[C/T]GAGCATCCACCCCTGAGATCATCACTCCCAGCCCAGACAGCAACAGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 1045 3024 26 62
Genomic Location:
Chromosome 15 (position 31102213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAACTCACAGCCTGAGAARCAAGACATAACTCCGGTCTCTGTGTCTCTC[A/T]GCACAAATGGAGCCCTGGAACGYRATACACTGGCCCTGGGCGCKCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Essential Splice Site 1527 3024 34 62
Genomic Location:
Chromosome 15 (position 31113171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTCTACCGATTTTCAGCCACAAGTAAAATTGTCACCACCTCTTCTGG[T/A]ATGCAAAGCCTTACTCAACATAAAGAAAAGTTGTGTGCGCGTTTAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045921 Nonsense 2346 3024 49 62
Genomic Location:
Chromosome 15 (position 31135366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACGCCGGTGATTGGTCGACGGTATGATGAGCTTCACGGTTCTCCAAGA[C/T]AAGATGGKAAGAATCAAGGAGTGGTTACGGTGACACGCAGYACCTCCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m5gq9r1n