ptpn6

Ensembl ID:
ENSDARG00000013916
ZFIN ID:
ZDB-GENE-030131-7513
Description:
tyrosine-protein phosphatase non-receptor type 6 [Source:RefSeq peptide;Acc:NP_956254]
Human Orthologue:
PTPN6
Human Description:
protein tyrosine phosphatase, non-receptor type 6 [Source:HGNC Symbol;Acc:9658]
Mouse Orthologue:
Ptpn6
Mouse Description:
protein tyrosine phosphatase, non-receptor type 6 Gene [Source:MGI Symbol;Acc:MGI:96055]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22882 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018713 Nonsense 271 337 7 9
Genomic Location (Zv9):
Chromosome 16 (position 34231256)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31769226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGTACAAGTTCATCTACTTGGCTGTGCTGCAGTACATAGAGTCCACT[A/T]AAGTCACACGAAGGGCCATCATGGTAGGAGAAACATGTGGGATAAAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link