LOC570141

Ensembl ID:
ENSDARG00000013907
Human Orthologue:
KBTBD13
Human Description:
kelch repeat and BTB (POZ) domain containing 13 [Source:HGNC Symbol;Acc:37227]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4307 Nonsense Mutation detected in F1 DNA During 2016
sa44335 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1331 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013044 Nonsense 288 461 2 3
ENSDART00000125073 Nonsense 249 422 3 4
Genomic Location:
Chromosome 25 (position 30600260)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACCACTATGTCCTCAGTTGAGATATATAATGTTGCCACAAAGGAGTG[G/A]ACTTTTGCAGCACCTTTACCTCGACCGGTAGCGGGGATCGCATGCACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013044 Essential Splice Site 450 461 None 3
ENSDART00000125073 Essential Splice Site 411 422 None 4
Genomic Location:
Chromosome 25 (position 30599773)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGAATGGATCTGTGTGGACATTTCTTCTCAGGATTCCAAAAGAGAGG[A/T]AAGAAGTGATTGTGTCTTAAATTGACTGAACCTTAGTAACCATGTTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013044 Nonsense 460 461 3 3
ENSDART00000125073 Nonsense 421 422 4 4
Genomic Location:
Chromosome 25 (position 30599587)
KASP Assay ID:
554-1245.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCACACAAGAAAAANNNNTTATGTTCTATCACCATTTACTCACTGCCA[C/T]AATATATAAAAATGGCCTGACTTTCTTTCTTGGAGAAGACAGCAGAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link