LOC570141

Ensembl ID:
ENSDARG00000013907
Human Orthologue:
KBTBD13
Human Description:
kelch repeat and BTB (POZ) domain containing 13 [Source:HGNC Symbol;Acc:37227]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4307 Nonsense Mutation detected in F1 DNA During 2014
sa1331 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013044 Nonsense 288 461 2 3
ENSDART00000125073 Nonsense 249 422 3 4
Genomic Location:
Chromosome 25 (position 30600260)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACCACTATGTCCTCAGTTGAGATATATAATGTTGCCACAAAGGAGTG[G/A]ACTTTTGCAGCACCTTTACCTCGACCGGTAGCGGGGATCGCATGCACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013044 Nonsense 460 461 3 3
ENSDART00000125073 Nonsense 421 422 4 4
Genomic Location:
Chromosome 25 (position 30599587)
KASP Assay ID:
554-1245.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCACACAAGAAAAANNNNTTATGTTCTATCACCATTTACTCACTGCCA[C/T]AATATATAAAAATGGCCTGACTTTCTTTCTTGGAGAAGACAGCAGAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o6943ni9