LOC570141

Ensembl ID:
ENSDARG00000013907
Human Orthologue:
KBTBD13
Human Description:
kelch repeat and BTB (POZ) domain containing 13 [Source:HGNC Symbol;Acc:37227]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44335 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1331 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013044 Essential Splice Site 450 461 None 3
ENSDART00000125073 Essential Splice Site 411 422 None 4
Genomic Location (Zv9):
Chromosome 25 (position 30599773)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29167134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGAATGGATCTGTGTGGACATTTCTTCTCAGGATTCCAAAAGAGAGG[A/T]AAGAAGTGATTGTGTCTTAAATTGACTGAACCTTAGTAACCATGTTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013044 Nonsense 460 461 3 3
ENSDART00000125073 Nonsense 421 422 4 4
Genomic Location (Zv9):
Chromosome 25 (position 30599587)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29166948
KASP Assay ID:
554-1245.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCACACAAGAAAAANNNNTTATGTTCTATCACCATTTACTCACTGCCA[C/T]AATATATAAAAATGGCCTGACTTTCTTTCTTGGAGAAGACAGCAGAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link