pi4k2b

Ensembl ID:
ENSDARG00000013881
ZFIN ID:
ZDB-GENE-070112-990
Description:
Phosphatidylinositol 4-kinase type 2-beta [Source:UniProtKB/Swiss-Prot;Acc:Q49GP5]
Human Orthologue:
PI4K2B
Human Description:
phosphatidylinositol 4-kinase type 2 beta [Source:HGNC Symbol;Acc:18215]
Mouse Orthologue:
Pi4k2b
Mouse Description:
phosphatidylinositol 4-kinase type 2 beta Gene [Source:MGI Symbol;Acc:MGI:1914323]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32630 Nonsense Mutation detected in F1 DNA During 2017
sa19455 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033018 Nonsense 378 501 7 10
Genomic Location (Zv9):
Chromosome 1 (position 14006214)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14593000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTATAGATAATGGTTTGGCCTTCCCCTTTAAACATCCTGATGAGTGG[A/T]GAGCATGTATGTATATTTTTCTTATGTTATTATATATGCATAACATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033018 Nonsense 446 501 10 10
Genomic Location (Zv9):
Chromosome 1 (position 14011096)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14597882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAACCCACTTCTATGGAAAATCTTACTTGTTCTTTTGAAATAGATCT[T/A]AAACCTGACACAGGCTTTGAAAGATGGGAAGAGCCCGATCCAGCTAGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link