si:ch211-287b5.3

Ensembl ID:
ENSDARG00000013863
ZFIN ID:
ZDB-GENE-060503-229
Description:
Protein FAM133 [Source:UniProtKB/Swiss-Prot;Acc:A1A5I1]
Human Orthologues:
AC021171.1, FAM133A, FAM133B
Human Descriptions:
family with sequence similarity 133, member A [Source:HGNC Symbol;Acc:26748]
family with sequence similarity 133, member B [Source:HGNC Symbol;Acc:28629]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NGY4]
Mouse Orthologue:
Fam133b
Mouse Description:
family with sequence similarity 133, member B Gene [Source:MGI Symbol;Acc:MGI:1915402]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8677 Nonsense Mutation detected in F1 DNA During 2017
sa36896 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052952 Nonsense 48 248 3 12
ENSDART00000089547 Nonsense 48 259 3 11
ENSDART00000135648 Nonsense 89 226 3 8
ENSDART00000140857 Nonsense 48 216 3 9

The following transcripts of ENSDARG00000013863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 41300419)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40752957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTTATGTGCATTTGCTTTGTACATCAGGGAGGAGGTGAAAGAACAGT[T/A]GGAAAAGAAAAGGAAAGGCTCCAGAGCCCTGGCTGATTTTGAGGACAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052952 Nonsense 247 248 12 12
ENSDART00000089547 Nonsense 258 259 11 11
ENSDART00000135648   None 226 None 8
ENSDART00000140857   None 216 None 9

The following transcripts of ENSDARG00000013863 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 41308016)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40760554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATAAGAAACACAGCAAAAAGAAAAAGAGGAAGACCTCCAGCTCGGAGT[T/A]GGACTGAAGGTGCTAGCGGCGGCTGGATTTGTGAATGGTAACGGAAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link