armc1

Ensembl ID:
ENSDARG00000013861
ZFIN ID:
ZDB-GENE-041212-33
Description:
armadillo repeat-containing protein 1 [Source:RefSeq peptide;Acc:NP_001008609]
Human Orthologue:
ARMC1
Human Description:
armadillo repeat containing 1 [Source:HGNC Symbol;Acc:17684]
Mouse Orthologue:
Armc1
Mouse Description:
armadillo repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:1921502]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6769 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012399 Essential Splice Site 85 275 3 7
ENSDART00000127044 Essential Splice Site 85 243 3 8
Genomic Location:
Chromosome 24 (position 25322885)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGGGCGAGCTGGGAATGATGCTGAGCCTGCAGAACGTCATGCAGAAG[T/A]AAGTCACTGCCACAAAACWTGAAGCCAACACGARCTCGCTTTGCACTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cucotgr7