ptpmt1

Ensembl ID:
ENSDARG00000013860
ZFIN ID:
ZDB-GENE-070112-272
Description:
protein-tyrosine phosphatase mitochondrial 1 [Source:RefSeq peptide;Acc:NP_001073656]
Human Orthologue:
PTPMT1
Human Description:
protein tyrosine phosphatase, mitochondrial 1 [Source:HGNC Symbol;Acc:26965]
Mouse Orthologue:
Ptpmt1
Mouse Description:
protein tyrosine phosphatase, mitochondrial 1 Gene [Source:MGI Symbol;Acc:MGI:1913711]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31583 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074458 Nonsense 115 183 3 4
ENSDART00000144862 Nonsense 115 155 3 4

The following transcripts of ENSDARG00000013860 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 39971344)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38307984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTGAGCACATCCACAAGGGTGTGGATTTTGCCTTGAGACACAGAGAA[C/T]AGGGCAGCAGTGTCTATATTCACTGTAAGGCTGGCCGCTCACGCAGTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link