cdc14aa

Ensembl ID:
ENSDARG00000013858
ZFIN ID:
ZDB-GENE-040426-1214
Description:
CDC14 cell division cycle 14 homolog A (S. cerevisiae), a [Source:RefSeq peptide;Acc:NP_957443]
Human Orthologue:
CDC14A
Human Description:
CDC14 cell division cycle 14 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:1718]
Mouse Orthologue:
Cdc14a
Mouse Description:
CDC14 cell division cycle 14 homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2442676]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15795 Nonsense Available for shipment Available now
sa8511 Nonsense Mutation detected in F1 DNA During 2014
sa19671 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022963 Nonsense 85 592 4 15
Genomic Location:
Chromosome 2 (position 6786642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGTCTTTCACACTGTCSAGAAAGCGCATYATCCATTACACCAGTTA[C/A]GATCAGCGAAAGAGAGCCAACGCAGCCTTCCTCAKCGGCRCKTATGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022963 Nonsense 260 592 9 15
Genomic Location:
Chromosome 2 (position 6798042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGACCTGTTCTTCGTAGACGGCACTACACCTAGTGATCTCCTTACAAGA[C/T]GATTTCTGCACATCTGTGAGAGMGCAAAGGGCGCTGTGGCTGTCCATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022963 Essential Splice Site 453 592 14 15
Genomic Location:
Chromosome 2 (position 6805888)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTATTTTGTTAGAAATGTTGTTAACCCCGCCTTATTCGCTCCACATA[G/A]TATCAATCCCCGTTTAGCCCATTCCCTTGGCAACCTCTACGATGACAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f7diw1m0