amy2a

Ensembl ID:
ENSDARG00000013856
ZFIN ID:
ZDB-GENE-040426-2393
Description:
amylase-3 protein [Source:RefSeq peptide;Acc:NP_998176]
Human Orthologues:
AMY1A, AMY1B, AMY1C, AMY2A, AMY2B
Human Descriptions:
amylase, alpha 1A (salivary) [Source:HGNC Symbol;Acc:474]
amylase, alpha 1B (salivary) [Source:HGNC Symbol;Acc:475]
amylase, alpha 1C (salivary) [Source:HGNC Symbol;Acc:476]
amylase, alpha 2A (pancreatic) [Source:HGNC Symbol;Acc:477]
amylase, alpha 2B (pancreatic) [Source:HGNC Symbol;Acc:478]
Mouse Orthologues:
Amy1, Amy2a1, Amy2a2, Amy2a3, Amy2a4, Amy2a5
Mouse Descriptions:
amylase 1, salivary Gene [Source:MGI Symbol;Acc:MGI:88019]
amylase 2a1 Gene [Source:MGI Symbol;Acc:MGI:104548]
amylase 2a2 Gene [Source:MGI Symbol;Acc:MGI:3711220]
amylase 2a3 Gene [Source:MGI Symbol;Acc:MGI:3714985]
amylase 2a4 Gene [Source:MGI Symbol;Acc:MGI:3711258]
amylase 2a5 Gene [Source:MGI Symbol;Acc:MGI:88020]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7487 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003035 Missense 114 512 3 10
Genomic Location:
Chromosome 2 (position 15442034)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTCRGACTGGTCTGTTGTTGTAGGTGAACATTTATGTTGATGCAGTCA[T/A]CAACCACATGTGTGGATCTGGTGGTGGATCAGGTACCCACTCAAGCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d48ryhza