lmo4a

Ensembl ID:
ENSDARG00000013853
ZFIN ID:
ZDB-GENE-010702-1
Description:
LIM domain only 4a [Source:RefSeq peptide;Acc:NP_817093]
Human Orthologue:
LMO4
Human Description:
LIM domain only 4 [Source:HGNC Symbol;Acc:6644]
Mouse Orthologue:
Lmo4
Mouse Description:
LIM domain only 4 Gene [Source:MGI Symbol;Acc:MGI:109360]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2205 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa2205
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085219 Essential Splice Site 80 167 2 5

The following transcripts of ENSDARG00000013853 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 34550494)
KASP Assay ID:
554-2569.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGCTTCAGCAAAGGAGGGATGATCCTCTGCAGGAACGATTACATCAG[G/A]TACTAAAAGAAACAGGCAGTTGGGGGGTTTGGCGGGACTGATGTAGAAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aiif5xea