egfra

Ensembl ID:
ENSDARG00000013847
ZFIN ID:
ZDB-GENE-030918-1
Description:
epidermal growth factor receptor [Source:RefSeq peptide;Acc:NP_919405]
Human Orthologue:
EGFR
Human Description:
epidermal growth factor receptor [Source:HGNC Symbol;Acc:3236]
Mouse Orthologue:
Egfr
Mouse Description:
epidermal growth factor receptor Gene [Source:MGI Symbol;Acc:MGI:95294]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14931 Nonsense Available for shipment Available now
sa19660 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11905 Nonsense Available for shipment Available now
sa19661 Nonsense Available for shipment Available now
sa3385 Nonsense Mutation detected in F1 DNA During 2014
sa16195 Essential Splice Site Available for shipment Available now
sa1683 Nonsense Available for shipment Available now
sa15365 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14931
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027219 Nonsense 31 1172 1 32
ENSDART00000088591 Nonsense 17 1174 1 33
ENSDART00000108964 Nonsense 45 503 2 12
ENSDART00000128514 Nonsense 45 389 2 9
ENSDART00000131374 Nonsense 45 625 2 15
ENSDART00000136906 Nonsense 45 760 2 19
ENSDART00000147261 None None 243 None 5

The following transcripts of ENSDARG00000013847 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4264286)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGAGCAAACAACAAACTGACTCTTCTGGGAACRGTGGAAGACCATTA[T/A]CAGGTTCTGCTCAGAATGTACAGAAACKGCACTGTGGTTCTGGAGAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027219 Essential Splice Site 280 1172 6 32
ENSDART00000088591 Essential Splice Site 268 1174 7 33
ENSDART00000108964 Essential Splice Site 294 503 7 12
ENSDART00000128514 Essential Splice Site 294 389 7 9
ENSDART00000131374 Essential Splice Site 294 625 7 15
ENSDART00000136906 Essential Splice Site 294 760 7 19
ENSDART00000147261 None None 243 None 5

The following transcripts of ENSDARG00000013847 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4272705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCATATGGGAAGTACAGCTTTGGGGCGACGTGCATCAAGACATGCCCAC[G/A]TAAGTCTTTTATGTGAATTTGTGCTGTTCCAGAGTTTCTACAAGGGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027219 Nonsense 283 1172 7 32
ENSDART00000088591 Nonsense 271 1174 8 33
ENSDART00000108964 Nonsense 297 503 8 12
ENSDART00000128514 Nonsense 297 389 8 9
ENSDART00000131374 Nonsense 297 625 8 15
ENSDART00000136906 Nonsense 297 760 8 19
ENSDART00000147261 None None 243 None 5

The following transcripts of ENSDARG00000013847 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4275698)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGKTTGTGGTTAATGGTGNTTTTTTTGTCTGTTTTTTTCCTCAGACAACTA[T/A]GTGGTGACGGATCACGGGGCCTGTGTGAGAACATGCAGCCCTGGCACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027219 Nonsense 569 1172 14 32
ENSDART00000088591 Nonsense 557 1174 15 33
ENSDART00000108964 None None 503 None 12
ENSDART00000128514 None None 389 None 9
ENSDART00000131374 Nonsense 583 625 15 15
ENSDART00000136906 Nonsense 583 760 15 19
ENSDART00000147261 None None 243 None 5

The following transcripts of ENSDARG00000013847 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4286350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAACATTTTGTCCAGGGACCCGACAAATGTACAGTGTGTGCAAACTA[T/G]AAAGACGGACCGCACTGTGTGCATCGCTGCCCGCAAGGTGTACCAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3385
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027219 Nonsense 592 1172 14 32
ENSDART00000088591 Nonsense 580 1174 15 33
ENSDART00000108964 None None 503 None 12
ENSDART00000128514 None None 389 None 9
ENSDART00000131374 Nonsense 606 625 15 15
ENSDART00000136906 Nonsense 606 760 15 19
ENSDART00000147261 None None 243 None 5

The following transcripts of ENSDARG00000013847 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4286418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCATCGCTGCCCGCAAGGTGTACCAGGAGAGAAAGACACACTCATCT[G/A]GAAATACGCTGACGTGACACACGTTTGCCAGCCCTGTCATGAAAACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027219 Essential Splice Site 611 1172 14 32
ENSDART00000088591 Essential Splice Site 599 1174 15 33
ENSDART00000108964 None None 503 None 12
ENSDART00000128514 None None 389 None 9
ENSDART00000131374 None 625 625 15 15
ENSDART00000136906 Essential Splice Site 625 760 15 19
ENSDART00000147261 None None 243 None 5

The following transcripts of ENSDARG00000013847 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4286476)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGACGTGACACACGTTTGCCAGCCCTGTCATGAAAACTGCACCCAGGG[G/T]TGAGACAGACAWMGCATATGAGCCTNNNNNTTCAATGAAAATACACMAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027219 Nonsense 1104 1172 32 32
ENSDART00000088591 Nonsense 1106 1174 33 33
ENSDART00000108964 None None 503 None 12
ENSDART00000128514 None None 389 None 9
ENSDART00000131374 None None 625 None 15
ENSDART00000136906 None None 760 None 19
ENSDART00000147261 Nonsense 175 243 5 5

The following transcripts of ENSDARG00000013847 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4304373)
KASP Assay ID:
554-1629.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGACCCTCCTGCACTCCTCCCCAGCGCTGGACGAGACGGAAGAGGAGTA[T/A]CTGAACTGCTTCAAGAGCCCGGCTCCGGCTTCAGTGGTGGAGTATCTGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027219 Nonsense 1119 1172 32 32
ENSDART00000088591 Nonsense 1121 1174 33 33
ENSDART00000108964 None None 503 None 12
ENSDART00000128514 None None 389 None 9
ENSDART00000131374 None None 625 None 15
ENSDART00000136906 None None 760 None 19
ENSDART00000147261 Nonsense 190 243 5 5

The following transcripts of ENSDARG00000013847 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 4304418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTAWCTGAACTGCTTCAAGAGCCCGGCTCCGGCTTCAGTGGTGGAGTA[T/A]CTGAACAMRTCCCACACACAGCTGCTCTCCACAAAGCCCTTCTTCAGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Glioma: Chromosome 7p11.2 (EGFR) variation influences glioma risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xt934nkl