ttc14

Ensembl ID:
ENSDARG00000013845
ZFIN ID:
ZDB-GENE-050327-26
Description:
tetratricopeptide repeat protein 14 [Source:RefSeq peptide;Acc:NP_001014336]
Human Orthologue:
TTC14
Human Description:
tetratricopeptide repeat domain 14 [Source:HGNC Symbol;Acc:24697]
Mouse Orthologue:
Ttc14
Mouse Description:
tetratricopeptide repeat domain 14 Gene [Source:MGI Symbol;Acc:MGI:1914370]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12660 Nonsense Available for shipment Available now
sa12653 Nonsense Available for shipment Available now
sa17378 Essential Splice Site Available for shipment Available now
sa3210 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7992 Nonsense Mutation detected in F1 DNA During 2014
sa11411 Nonsense Available for shipment Available now
sa15413 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028085 Nonsense 7 665 1 12
ENSDART00000028085 Nonsense 7 665 1 12
Genomic Location:
Chromosome 22 (position 40596979)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTAAATATGTGTGTTTGCAGACMCTGAAGATGGACAGAGATTTACTC[C/T]GACAGTCTGTGTCGTTTCACGGGGAAAACCTGCTGTCGCTGTTGAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028085 Nonsense 7 665 1 12
ENSDART00000028085 Nonsense 7 665 1 12
Genomic Location:
Chromosome 22 (position 40596979)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTAAATATGTGTGTTTGCAGACMCTGAAGATGGACAGAGATTTACTC[C/T]GACAGTCTGTGTCGTTTCACGGGGAAAACCTGCTGTCGCTGTTGAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028085 Essential Splice Site 151 665 3 12
Genomic Location:
Chromosome 22 (position 40594059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCACYRCTGGTGGACTGAARAGAGACATTGAGGAWCTTGAGATYAAG[G/A]TGTGCTTGCATAGTTKGTCTCTTTATTGTTGTRSCTATTTATTAGACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028085 Essential Splice Site 180 665 4 12
Genomic Location:
Chromosome 22 (position 40591431)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCACGATGATCCTTTGTCGTATTACCAGATCGGGGATTTAATCAGAGG[T/A]GYGTTTTTTATATTTATTTTCTCGTTCTCAAAAACTTGTATTTGAGCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028085 Nonsense 265 665 6 12
Genomic Location:
Chromosome 22 (position 40588118)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCGTTAAACGTGGATTTCCTTCTGGGCAAACTGGGAATCAGTGACACA[C/T]AGACTCCTTCACTCATGAGGGGTTTGCAGAGGTGTGTGTTTGGCCTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028085 Nonsense 380 665 9 12
Genomic Location:
Chromosome 22 (position 40583550)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAAACGCTAAGAAATACCTGTGCCAGACGCTGGTGGARCGCGGAGGA[C/T]AGTACGTCTGTTTATTCCCGCTTTACATCTTTTATACCTCACCAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028085 Nonsense 415 665 10 12
Genomic Location:
Chromosome 22 (position 40582515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTTTAGACGACACGTTTAAAGAGGCGGCAGAGGYTCTGGAGAAACTG[C/T]AGATCCGCATCCAGGTGAGCTGGAGAAACCTGTCCGCCAGTCCGCATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zxxn5321