sept5a

Ensembl ID:
ENSDARG00000013843
ZFIN ID:
ZDB-GENE-030131-7868
Description:
septin 5a [Source:RefSeq peptide;Acc:NP_956282]
Human Orthologue:
SEPT5
Human Description:
septin 5 [Source:HGNC Symbol;Acc:9164]
Mouse Orthologue:
Sept5
Mouse Description:
septin 5 Gene [Source:MGI Symbol;Acc:MGI:1195461]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34286 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025535 Essential Splice Site 238 370 7 11
ENSDART00000099102 Essential Splice Site 237 369 8 12
ENSDART00000138199   None 100 None 3
ENSDART00000138462   None 100 None 4
Genomic Location (Zv9):
Chromosome 8 (position 4806371)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4549312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTCTGATGAAGAAGAGGAGTTCAAACAGATGGACAAAGAGCTGAAGG[T/G]CTCTACTATAGTGAATCTTCATTTTATATCAAGCCTCCATAAAGATACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link