Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tbc1d19
- Ensembl ID:
- ENSDARG00000013842
- ZFIN ID:
- ZDB-GENE-040426-1265
- Description:
- TBC1 domain family member 19 [Source:RefSeq peptide;Acc:NP_956785]
- Human Orthologue:
- TBC1D19
- Human Description:
- TBC1 domain family, member 19 [Source:HGNC Symbol;Acc:25624]
- Mouse Orthologue:
- Tbc1d19
- Mouse Description:
- TBC1 domain family, member 19 Gene [Source:MGI Symbol;Acc:MGI:1914499]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa27080 | Essential Splice Site | Mutation detected in F1 DNA | During 2017 |
Mutation Details
- Allele Name:
- sa27080
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000025308 | Essential Splice Site | 222 | 526 | 9 | 21 |
| ENSDART00000136918 | Essential Splice Site | 165 | 469 | 7 | 19 |
The following transcripts of ENSDARG00000013842 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 62908165)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 61955363 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTCTTATGGACAGCTTGGTATAGACGATCACACTCATGTTCCTCCAGG[T/A]ATTTTTTTTCTCATATTACCCATATTATATTTATGTAGATGGGGTGAGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
