tbc1d19

Ensembl ID:
ENSDARG00000013842
ZFIN ID:
ZDB-GENE-040426-1265
Description:
TBC1 domain family member 19 [Source:RefSeq peptide;Acc:NP_956785]
Human Orthologue:
TBC1D19
Human Description:
TBC1 domain family, member 19 [Source:HGNC Symbol;Acc:25624]
Mouse Orthologue:
Tbc1d19
Mouse Description:
TBC1 domain family, member 19 Gene [Source:MGI Symbol;Acc:MGI:1914499]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27080 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa27080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025308 Essential Splice Site 222 526 9 21
ENSDART00000136918 Essential Splice Site 165 469 7 19

The following transcripts of ENSDARG00000013842 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 62908165)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 61955363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCTTATGGACAGCTTGGTATAGACGATCACACTCATGTTCCTCCAGG[T/A]ATTTTTTTTCTCATATTACCCATATTATATTTATGTAGATGGGGTGAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link