tbc1d19

Ensembl ID:: ENSDARG00000013842
ZFIN ID:: ZDB-GENE-040426-1265
Description:: TBC1 domain family member 19 [Source:RefSeq peptide;Acc:NP_956785]
Human Orthologue:: TBC1D19
Human Description:: TBC1 domain family, member 19 [Source:HGNC Symbol;Acc:25624]
Mouse Orthologue:: Tbc1d19
Mouse Description:: TBC1 domain family, member 19 Gene [Source:MGI Symbol;Acc:MGI:1914499]

Alleles

There are 2 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa27080	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa5450	Nonsense	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa27080
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000025308	Essential Splice Site	222	526	9	21
ENSDART00000136918	Essential Splice Site	165	469	7	19

The following transcripts of ENSDARG00000013842 do not overlap with this mutation:

ENSDART00000141016

Genomic Location:: Chromosome 7 (position 62908165)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: CTTTCTTATGGACAGCTTGGTATAGACGATCACACTCATGTTCCTCCAGG[T/A]ATTTTTTTTCTCATATTACCCATATTATATTTATGTAGATGGGGTGAGCT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa5450
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > G
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000025308	Nonsense	394	526	17	21
ENSDART00000136918	Nonsense	337	469	15	19

The following transcripts of ENSDARG00000013842 do not overlap with this mutation:

ENSDART00000141016

Genomic Location:: Chromosome 7 (position 62938387)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TTTTTATATAACGAGCCATCTAAGCTGTACAGTGTGTTTAGGGAGATGTA[T/G]ATTCGCTACTTCTTCAGACTACACTCCATCTCCTCACATCCATCTGTAAG
Associated Phenotype:: Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: