tbc1d19

Ensembl ID:
ENSDARG00000013842
ZFIN ID:
ZDB-GENE-040426-1265
Description:
TBC1 domain family member 19 [Source:RefSeq peptide;Acc:NP_956785]
Human Orthologue:
TBC1D19
Human Description:
TBC1 domain family, member 19 [Source:HGNC Symbol;Acc:25624]
Mouse Orthologue:
Tbc1d19
Mouse Description:
TBC1 domain family, member 19 Gene [Source:MGI Symbol;Acc:MGI:1914499]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5450 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025308 Nonsense 394 526 17 21
ENSDART00000136918 Nonsense 337 469 15 19

The following transcripts of ENSDARG00000013842 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 62938387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTATATAACGAGCCATCTAAGCTGTACAGTGTGTTTAGGGAGATGTA[T/G]ATTCGCTACTTCTTCAGACTACACTCCATCTCCTCACATCCATCTGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/10mhqmui