abl2

Ensembl ID:
ENSDARG00000013841
ZFIN ID:
ZDB-GENE-020809-2
Description:
tyrosine-protein kinase ABL2 [Source:RefSeq peptide;Acc:NP_001116177]
Human Orthologue:
ABL2
Human Description:
v-abl Abelson murine leukemia viral oncogene homolog 2 [Source:HGNC Symbol;Acc:77]
Mouse Orthologue:
Abl2
Mouse Description:
v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) Gene [Source:MGI

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21232 Nonsense Mutation detected in F1 DNA During 2014
sa7125 Nonsense Mutation detected in F1 DNA During 2014
sa13684 Essential Splice Site Available for shipment Available now
sa13149 Nonsense Available for shipment Available now
sa11098 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 171 1135 3 11
ENSDART00000138548 Nonsense 171 587 3 10
Genomic Location:
Chromosome 8 (position 15485188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGGGAAAGCGAGAGCAGCCCCGGCCAGCTCTCCATCTCTCTTCGCTA[T/A]GAGGGACGGGTCTATCATTACCGCATCAACACGGCCTCTGATGGAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 338 1135 6 11
ENSDART00000138548 Nonsense 338 587 6 10
Genomic Location:
Chromosome 8 (position 15489794)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGCCCCATGGGAACCTGCTGGATTACCTGCGTGAGTGTGAAAGGGAC[C/T]AGGTGAATGCTGTGGTGCTGCTCTACATGGCYACTCAGATCTCCTCCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Essential Splice Site 563 1135 None 11
ENSDART00000138548 None 563 587 10 10
Genomic Location:
Chromosome 8 (position 15492320)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAGAACAAAGAGAATATGGRGGAGGCAGGACCCCAYGGCCCTGCAGG[T/A]ATACAGGCTCAACTCCGGCTCAGTCGGCTCAGAAAGAAGCTCAAGAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548 None None 587 None 10
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548 None None 587 None 10
Genomic Location:
Chromosome 8 (position 15497005)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGWCCGTCAATACCACCACCACAAGTGCCTCCAGCCCCTGTAGTTCCCT[C/A]GAGTAACAACACMACCCAAACCAARTTGGCTAATGGTGCTTCAAGTGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548 None None 587 None 10
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548 None None 587 None 10
Genomic Location:
Chromosome 8 (position 15497005)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGWCCGTCAATACCACCACCACAAGTGCCTCCAGCCCCTGTAGTTCCCT[C/A]GAGTAACAACACMACCCAAACCAARTTGGCTAATGGTGCTTCAAGTGGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgE grass sensitization: A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vs3yga7n