abl2

Ensembl ID:
ENSDARG00000013841
ZFIN ID:
ZDB-GENE-020809-2
Description:
tyrosine-protein kinase ABL2 [Source:RefSeq peptide;Acc:NP_001116177]
Human Orthologue:
ABL2
Human Description:
v-abl Abelson murine leukemia viral oncogene homolog 2 [Source:HGNC Symbol;Acc:77]
Mouse Orthologue:
Abl2
Mouse Description:
v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) Gene [Source:MGI

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21232 Nonsense Available for shipment Available now
sa41154 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7125 Nonsense Mutation detected in F1 DNA During 2016
sa34353 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa13684 Essential Splice Site Available for shipment Available now
sa13149 Nonsense Available for shipment Available now
sa11098 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 171 1135 3 11
ENSDART00000138548 Nonsense 171 587 3 10
Genomic Location (Zv9):
Chromosome 8 (position 15485188)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14930532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGGGAAAGCGAGAGCAGCCCCGGCCAGCTCTCCATCTCTCTTCGCTA[T/A]GAGGGACGGGTCTATCATTACCGCATCAACACGGCCTCTGATGGAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Essential Splice Site 307 1135 5 11
ENSDART00000138548 Essential Splice Site 307 587 5 10
Genomic Location (Zv9):
Chromosome 8 (position 15487663)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14933007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCAGTCATGAAGGAGGTCAAACATCCCAATCTAGTACAGTTACTGGG[T/C]GAGTAAACTATCATTAAAGGAAATAGTTCACCCAAAAATGAAAATAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 338 1135 6 11
ENSDART00000138548 Nonsense 338 587 6 10
Genomic Location (Zv9):
Chromosome 8 (position 15489794)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14935138
KASP Assay ID:
554-5145.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGCCCCATGGGAACCTGCTGGATTACCTGCGTGAGTGTGAAAGGGAC[C/T]AGGTGAATGCTGTGGTGCTGCTCTACATGGCYACTCAGATCTCCTCCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Splice Site, Nonsense 479 1135 9 11
ENSDART00000138548 Splice Site, Nonsense 479 587 9 10
Genomic Location (Zv9):
Chromosome 8 (position 15490760)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14936104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTAGTTTTGAGGTATTAGGTAAGCATGTTTGGTTTGTGTATTGGCAGG[C/A]TGGCAGTGGAGTCCACTGGATAGACCCTCATTTGCTGAGATTCATCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Essential Splice Site 563 1135 None 11
ENSDART00000138548   563 587 10 10
Genomic Location (Zv9):
Chromosome 8 (position 15492320)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14937664
KASP Assay ID:
2260-0316.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAGAACAAAGAGAATATGGRGGAGGCAGGACCCCAYGGCCCTGCAGG[T/A]ATACAGGCTCAACTCCGGCTCAGTCGGCTCAGAAAGAAGCTCAAGAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548   None 587 None 10
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548   None 587 None 10
Genomic Location (Zv9):
Chromosome 8 (position 15497005)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14942349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGWCCGTCAATACCACCACCACAAGTGCCTCCAGCCCCTGTAGTTCCCT[C/A]GAGTAACAACACMACCCAAACCAARTTGGCTAATGGTGCTTCAAGTGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548   None 587 None 10
ENSDART00000041697 Nonsense 988 1135 11 11
ENSDART00000138548   None 587 None 10
Genomic Location (Zv9):
Chromosome 8 (position 15497005)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14942349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGWCCGTCAATACCACCACCACAAGTGCCTCCAGCCCCTGTAGTTCCCT[C/A]GAGTAACAACACMACCCAAACCAARTTGGCTAATGGTGCTTCAAGTGGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgE grass sensitization: A genome-wide meta-analysis of genetic variants associated with allergic rhinitis and grass sensitization and their interaction with birth order. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link