aldh3d1

Ensembl ID:
ENSDARG00000013839
ZFIN ID:
ZDB-GENE-021120-3
Description:
aldehyde dehydrogenase family 3 member B1 [Source:RefSeq peptide;Acc:NP_775328]
Human Orthologue:
ALDH3B2
Human Description:
aldehyde dehydrogenase 3 family, member B2 [Source:HGNC Symbol;Acc:411]
Mouse Orthologues:
1700055N04Rik, Aldh3b1, Aldh3b2
Mouse Descriptions:
aldehyde dehydrogenase 3 family, member B1 Gene [Source:MGI Symbol;Acc:MGI:1914939]
aldehyde dehydrogenase 3 family, member B2 Gene [Source:MGI Symbol;Acc:MGI:2147613]
RIKEN cDNA 1700055N04 gene Gene [Source:MGI Symbol;Acc:MGI:1920708]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11770 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020017 Nonsense 186 473 6 10
Genomic Location:
Chromosome 3 (position 34207941)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAGAAACCAAGACATTGCTTGAGAACCGATTTGATCATATCTTCTA[C/A]AYGGGTATGTTTTCATTKTTATTAATTHATTTCATCTTTATTTCTATAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mcvpv8ax