osbpl2

Ensembl ID:
ENSDARG00000013830
ZFIN ID:
ZDB-GENE-030131-6138
Description:
oxysterol-binding protein-related protein 2 [Source:RefSeq peptide;Acc:NP_956166]
Human Orthologue:
OSBPL1A
Human Description:
oxysterol binding protein-like 1A [Source:HGNC Symbol;Acc:16398]
Mouse Orthologue:
Osbpl1a
Mouse Description:
oxysterol binding protein-like 1A Gene [Source:MGI Symbol;Acc:MGI:1927551]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39398 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010697 Splice Site, Nonsense 440 472 14 14
ENSDART00000081448 Splice Site, Nonsense 440 472 16 16
ENSDART00000130008 Splice Site, Nonsense 439 467 16 17
ENSDART00000136486   None 124 None 5
ENSDART00000137751   None 198 None 7
Genomic Location (Zv9):
Chromosome 23 (position 9658099)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9616240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTTTTGTTTTTAAGCTAACCCACCTATCAATCTGTTGTAGGT[G/A]GTTTCAGTTAGGCACAAACCCATACACCGGATCACAGGACTGGCTGTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Osteoporosis: An integration of genome-wide association study and gene expression profiling to prioritize the discovery of novel susceptibility Loci for osteoporosis-related traits. (View Study)
  • Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link