myo5c

Ensembl ID:
ENSDARG00000013782
Human Orthologue:
MYO5C
Human Description:
myosin VC [Source:HGNC Symbol;Acc:7604]
Mouse Orthologue:
Myo5c
Mouse Description:
myosin VC Gene [Source:MGI Symbol;Acc:MGI:2442485]

Alleles

There are 14 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3316 Nonsense F2 line generated During 2014
sa19356 Nonsense Mutation detected in F1 DNA During 2014
sa4315 Nonsense Mutation detected in F1 DNA During 2014
sa16770 Nonsense Available for shipment Available now
sa11146 Essential Splice Site Available for shipment Available now
sa14963 Essential Splice Site Available for shipment Available now
sa12025 Nonsense Available for shipment Available now
sa11888 Nonsense Available for shipment Available now
sa6792 Nonsense Mutation detected in F1 DNA During 2014
sa6793 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3291 Essential Splice Site F2 line generated During 2014
sa9570 Nonsense Available for shipment Available now
sa25221 Nonsense Mutation detected in F1 DNA During 2014
sa3298 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3316
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 91 1746 3 51
Genomic Location:
Chromosome 25 (position 4803354)
KASP Assay ID:
554-3455.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCTCTCAGTTACCTTCACGAGCCGGCCGTGCTGCATAACCTCAAAGTC[C/T]GATTTGTTGAGTCCAAAATCATCTACACGTATTGCGGTRGGTTGGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 156 1746 5 51
ENSDART00000045539 Nonsense 156 1746 5 51
Genomic Location:
Chromosome 25 (position 4804837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATATTTTAGTGAAGCATCTTTTGTTCAACTTTCAGGAATAACAAAAAT[C/T]AGTCCATCATTGTGAGCGGTGAGTCCGGGGCCGGAAAGACTGTATCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 156 1746 5 51
ENSDART00000045539 Nonsense 156 1746 5 51
Genomic Location:
Chromosome 25 (position 4804837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATATTTTAGTGAAGCATCTTTTGTTCAACTTTCAGGAATAACAAAAAT[C/T]AGTCCATCATTGTGAGCGGTGAGTCCGGGGCCGGAAAGACTGTATCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 241 1746 6 51
Genomic Location:
Chromosome 25 (position 4805201)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGTTTCGATAAAAGATACCAAATCATTGGTGCCAACATGAGGACGTA[T/A]CTTCTGGAAAAGTCCAGGGTGRTGTTTCAGGTGAATATCATTCGAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Essential Splice Site 439 1746 10 51
Genomic Location:
Chromosome 25 (position 4809498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCCCTGGSAAACAGCATTCGTTTATTGGGGTCTTGGATATTTACGGG[T/A]ACGTCAAATTMAATTMAATTCAATTCAATTTAGCTTTATTTGTATAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Essential Splice Site 514 1746 13 51
Genomic Location:
Chromosome 25 (position 4813036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTATTGTGTTAGTTTGTTTAYTARCAAAGTCTTTTYTGATATCYCGCA[G/A]TTCCCGCAAGGCACTGATAAAAACTGGCTGCAAAAACTGTACAATTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 785 1746 19 51
ENSDART00000045539 Nonsense 785 1746 19 51
Genomic Location:
Chromosome 25 (position 4818358)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGACARAGACGCAGCTTTCTGAACATCARACAGGCGGCTCTCATCAYR[C/T]AGCTGTACGTGCGCGGGAAGAAGCAGATCAGGTGASAGTTAAAACTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 785 1746 19 51
ENSDART00000045539 Nonsense 785 1746 19 51
Genomic Location:
Chromosome 25 (position 4818358)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGACARAGACGCAGCTTTCTGAACATCARACAGGCGGCTCTCATCAYR[C/T]AGCTGTACGTGCGCGGGAAGAAGCAGATCAGGTGASAGTTAAAACTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 840 1746 20 51
Genomic Location:
Chromosome 25 (position 4818669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTTACCAGCTCGTCCTGAGAGCTGCRGTCACYATACAGGCCTTCACC[A/T]GAGGATGGAWGGCTCGSAAACGCTACAAAAAGGKNNNNTGACTTCTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Essential Splice Site 850 1746 20 51
Genomic Location:
Chromosome 25 (position 4818703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YATACAGGCCTTCACCWGAGGATGGAWGGCTCGSAAACGCTACAAAAAGG[T/G]NNNNTGACTTCTTATTCTTTGTTTAATACCTTATTATTTRATATTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3291
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Essential Splice Site 899 1746 21 51
Genomic Location:
Chromosome 25 (position 4818935)
KASP Assay ID:
554-2474.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGCTATCATACAGAGTCCAGCAGCTGCGTAAGAAAGTAGAGGAGCAG[G/A]TACAGTCATTCAAAAACACAGAGGAAAATGCGTATGTCAGTATGTMATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 1016 1746 25 51
Genomic Location:
Chromosome 25 (position 4821818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAATCTGTTCTCTGTTTTGTCAGGGTGGCAGAGCACAACAGTGAACTG[C/T]AGAAGGAAGACTCGGACAAAGAAATTGTGGCGATAAAAGAGGAAAACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 1107 1746 27 51
Genomic Location:
Chromosome 25 (position 4822912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTATTGTTGTTGTTTTTGTTAGCTAAGATGAATCTGATCACGAGG[C/T]AGCTGCTTGGTGATGCTACAGAGCAAGATCTCATCCAGAGGTGTGTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Essential Splice Site 1120 1746 27 51
Genomic Location:
Chromosome 25 (position 4822953)
KASP Assay ID:
554-2739.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACGAGGCAGCTGCTTGGTGATGCTACAGAGCAAGATCTCATCCAGAG[G/A]TGTGTCAGAATATTAGGATTAACATTGCTAATTGTTATTAGGNNCAGTTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mc4qbmsk