myo5c

Ensembl ID:
ENSDARG00000013782
Human Orthologue:
MYO5C
Human Description:
myosin VC [Source:HGNC Symbol;Acc:7604]
Mouse Orthologue:
Myo5c
Mouse Description:
myosin VC Gene [Source:MGI Symbol;Acc:MGI:2442485]

Alleles

There are 13 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16770 Nonsense Available for shipment Available now
sa11146 Essential Splice Site Available for shipment Available now
sa14963 Essential Splice Site Available for shipment Available now
sa11888 Nonsense Available for shipment Available now
sa12025 Nonsense Available for shipment Available now
sa6792 Nonsense Mutation detected in F1 DNA During 2016
sa6793 Essential Splice Site Mutation detected in F1 DNA During 2016
sa3291 Essential Splice Site F2 line generated During 2016
sa37990 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9570 Nonsense Available for shipment Available now
sa25221 Nonsense Mutation detected in F1 DNA During 2016
sa3298 Essential Splice Site Available for shipment Available now
sa44223 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 241 1746 6 51
Genomic Location (Zv9):
Chromosome 25 (position 4805201)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4666443
KASP Assay ID:
2261-9296.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGTTTCGATAAAAGATACCAAATCATTGGTGCCAACATGAGGACGTA[T/A]CTTCTGGAAAAGTCCAGGGTGRTGTTTCAGGTGAATATCATTCGAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Essential Splice Site 439 1746 10 51
Genomic Location (Zv9):
Chromosome 25 (position 4809498)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4670740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCCCTGGSAAACAGCATTCGTTTATTGGGGTCTTGGATATTTACGGG[T/A]ACGTCAAATTMAATTMAATTCAATTCAATTTAGCTTTATTTGTATAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Essential Splice Site 514 1746 13 51
Genomic Location (Zv9):
Chromosome 25 (position 4813036)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4674278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTATTGTGTTAGTTTGTTTAYTARCAAAGTCTTTTYTGATATCYCGCA[G/A]TTCCCGCAAGGCACTGATAAAAACTGGCTGCAAAAACTGTACAATTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 785 1746 19 51
ENSDART00000045539 Nonsense 785 1746 19 51
Genomic Location (Zv9):
Chromosome 25 (position 4818358)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4679600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGACARAGACGCAGCTTTCTGAACATCARACAGGCGGCTCTCATCAYR[C/T]AGCTGTACGTGCGCGGGAAGAAGCAGATCAGGTGASAGTTAAAACTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 785 1746 19 51
ENSDART00000045539 Nonsense 785 1746 19 51
Genomic Location (Zv9):
Chromosome 25 (position 4818358)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4679600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGACARAGACGCAGCTTTCTGAACATCARACAGGCGGCTCTCATCAYR[C/T]AGCTGTACGTGCGCGGGAAGAAGCAGATCAGGTGASAGTTAAAACTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 840 1746 20 51
Genomic Location (Zv9):
Chromosome 25 (position 4818669)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4679911
KASP Assay ID:
554-4622.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATTTACCAGCTCGTCCTGAGAGCTGCRGTCACYATACAGGCCTTCACC[A/T]GAGGATGGAWGGCTCGSAAACGCTACAAAAAGGKNNNNTGACTTCTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Essential Splice Site 850 1746 20 51
Genomic Location (Zv9):
Chromosome 25 (position 4818703)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4679945
KASP Assay ID:
554-5467.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YATACAGGCCTTCACCWGAGGATGGAWGGCTCGSAAACGCTACAAAAAGG[T/G]NNNNTGACTTCTTATTCTTTGTTTAATACCTTATTATTTRATATTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3291
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Essential Splice Site 899 1746 21 51
Genomic Location (Zv9):
Chromosome 25 (position 4818935)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4680177
KASP Assay ID:
554-2474.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGCTATCATACAGAGTCCAGCAGCTGCGTAAGAAAGTAGAGGAGCAG[G/A]TACAGTCATTCAAAAACACAGAGGAAAATGCGTATGTCAGTATGTMATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Essential Splice Site 954 1746 22 51
Genomic Location (Zv9):
Chromosome 25 (position 4821395)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4682637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGCTTTAGTGCAGAGGGCGAAAACAAACTCAGAGGAGGCCAATCAG[G/A]TAAAAGTGCTACGCAATATCTTTGTAATATTGAAGATAATTTTGAGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 1016 1746 25 51
Genomic Location (Zv9):
Chromosome 25 (position 4821818)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4683060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAATCTGTTCTCTGTTTTGTCAGGGTGGCAGAGCACAACAGTGAACTG[C/T]AGAAGGAAGACTCGGACAAAGAAATTGTGGCGATAAAAGAGGAAAACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 1107 1746 27 51
Genomic Location (Zv9):
Chromosome 25 (position 4822912)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4684154
KASP Assay ID:
554-7422.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTATTGTTGTTGTTTTTGTTAGCTAAGATGAATCTGATCACGAGG[C/T]AGCTGCTTGGTGATGCTACAGAGCAAGATCTCATCCAGAGGTGTGTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Essential Splice Site 1120 1746 27 51
Genomic Location (Zv9):
Chromosome 25 (position 4822953)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4684195
KASP Assay ID:
554-2739.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACGAGGCAGCTGCTTGGTGATGCTACAGAGCAAGATCTCATCCAGAG[G/A]TGTGTCAGAATATTAGGATTAACATTGCTAATTGTTATTAGGNNCAGTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045539 Nonsense 1558 1746 38 51
Genomic Location (Zv9):
Chromosome 25 (position 4836943)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4698185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGAGACTCCAGCACGTCTGAGGCCTTCAGCGTCAGCTCCATCCTGCAG[A/T]AGCTCAGCACCTTTAACTCCAGCATGTGTCAGCAGGGCATGGAGCCGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link