actn3a

Ensembl ID:
ENSDARG00000013755
ZFIN ID:
ZDB-GENE-000329-9
Description:
actinin alpha 3a [Source:RefSeq peptide;Acc:NP_571597]
Mouse Orthologue:
Actn3
Mouse Description:
actinin alpha 3 Gene [Source:MGI Symbol;Acc:MGI:99678]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13372 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005682 Nonsense 382 896 11 21
Genomic Location:
Chromosome 21 (position 26795207)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTKGCCTCCCCTTTTGCAGGATATCGCCAATGCTTGGAAGGGTCTGGAG[C/T]AGGTTGAAAAGGGCTATGAGGAGTGGCTGCTTACAGAAATTCGTCGTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w3nshyg6