lancl1

Ensembl ID:
ENSDARG00000013741
ZFIN ID:
ZDB-GENE-040924-1
Description:
LanC-like protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q90ZL2]
Human Orthologue:
LANCL1
Human Description:
LanC lantibiotic synthetase component C-like 1 (bacterial) [Source:HGNC Symbol;Acc:6508]
Mouse Orthologue:
Lancl1
Mouse Description:
LanC (bacterial lantibiotic synthetase component C)-like 1 Gene [Source:MGI Symbol;Acc:MGI:1336997]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11623 Nonsense Available for shipment Available now
sa7430 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016139 Nonsense 7 405 2 11

The following transcripts of ENSDARG00000013741 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 6539900)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAATGCTCTTTATTTCAGATCTCTTCAAAATGTCTGAACAACGAGCCT[T/A]GAAGAATCCTTATCCAGATTACACTGGGCTGGGATGTGCACAAGACTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016139 Missense 171 405 5 11

The following transcripts of ENSDARG00000013741 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 6531720)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGAGCTGCTGTACGGCAGAACGGGCTACCTTTACTCCCTCATTTTCG[T/A]CAACCARCAGTTCCAGCAGGAGAAGATCCCCTTTCARTACATTCAGCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y0yaxqm6