polr3gl

Ensembl ID:
ENSDARG00000013734
ZFIN ID:
ZDB-GENE-041010-32
Description:
DNA-directed RNA polymerase III subunit RPC7-like [Source:RefSeq peptide;Acc:NP_001005959]
Human Orthologue:
POLR3GL
Human Description:
polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like [Source:HGNC Symbol;Acc:28466]
Mouse Orthologue:
Polr3gl
Mouse Description:
polymerase (RNA) III (DNA directed) polypeptide G like Gene [Source:MGI Symbol;Acc:MGI:1917120]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22929 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014956 Essential Splice Site 36 212 2 8
Genomic Location (Zv9):
Chromosome 16 (position 45668313)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42926503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGAAAATCTCCCTCCGTCCTGCATCCAGCCGACACCTCTGTTCCCCG[T/G]GAGTCTTCAAGACACAACAATAAAGCCTCGTTTATAAACTGTTATACGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link