ap4b1l

Ensembl ID:
ENSDARG00000013726
ZFIN ID:
ZDB-GENE-040426-1284
Description:
AP-4 complex subunit beta-1 [Source:RefSeq peptide;Acc:NP_956632]
Human Orthologue:
AP4B1
Human Description:
adaptor-related protein complex 4, beta 1 subunit [Source:HGNC Symbol;Acc:572]
Mouse Orthologue:
Ap4b1
Mouse Description:
adaptor-related protein complex AP-4, beta 1 Gene [Source:MGI Symbol;Acc:MGI:1337130]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9375 Essential Splice Site Mutation detected in F1 DNA During 2016
sa29847 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018230 Essential Splice Site 400 729 7 11
ENSDART00000116215 Essential Splice Site 400 729 6 10
ENSDART00000018230 Essential Splice Site 400 729 7 11
ENSDART00000116215 Essential Splice Site 400 729 6 10
Genomic Location (Zv9):
Chromosome 23 (position 376595)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 347586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATCCTGACCRGCCTGCTGGCACTRAAGCAGGATCACATCACATCCGG[T/A]ACGAGAACACACACACCTCTGCATGATTTCTCTTATTGTTCACCCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018230 Nonsense 627 729 11 11
ENSDART00000116215 Nonsense 627 729 10 10
Genomic Location (Zv9):
Chromosome 23 (position 383552)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 354543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGTGTGCGGGTGCTGCTGTGTCCCCCGAGGCGTTTGAGCAGATGTGG[C/T]AGCAGCTGGAGGTCCTGCAGCGTCAGACGGTGTGTTTCTCTGGATGCGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link