ap4b1l

Ensembl ID:
ENSDARG00000013726
ZFIN ID:
ZDB-GENE-040426-1284
Description:
AP-4 complex subunit beta-1 [Source:RefSeq peptide;Acc:NP_956632]
Human Orthologue:
AP4B1
Human Description:
adaptor-related protein complex 4, beta 1 subunit [Source:HGNC Symbol;Acc:572]
Mouse Orthologue:
Ap4b1
Mouse Description:
adaptor-related protein complex AP-4, beta 1 Gene [Source:MGI Symbol;Acc:MGI:1337130]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9375 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5014 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5015 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018230 Essential Splice Site 400 729 7 11
ENSDART00000116215 Essential Splice Site 400 729 6 10
ENSDART00000018230 Essential Splice Site 400 729 7 11
ENSDART00000116215 Essential Splice Site 400 729 6 10
Genomic Location:
Chromosome 23 (position 376595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATCCTGACCRGCCTGCTGGCACTRAAGCAGGATCACATCACATCCGG[T/A]ACGAGAACACACACACCTCTGCATGATTTCTCTTATTGTTCACCCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018230 Essential Splice Site 400 729 7 11
ENSDART00000116215 Essential Splice Site 400 729 6 10
ENSDART00000018230 Essential Splice Site 400 729 7 11
ENSDART00000116215 Essential Splice Site 400 729 6 10
Genomic Location:
Chromosome 23 (position 376595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATCCTGACCRGCCTGCTGGCACTRAAGCAGGATCACATCACATCCGG[T/A]ACGAGAACACACACACCTCTGCATGATTTCTCTTATTGTTCACCCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018230 Nonsense 455 729 9 11
ENSDART00000116215 Nonsense 455 729 8 10
Genomic Location:
Chromosome 23 (position 381603)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTGTGGCTGCTGGGCGAGCATGYGGATCAGATCAGCAGCGCCCCCTA[T/A]CTGCTGGAGGTCTACATCGACGGGCTGAAGACGGAGCTGTCTGCGSCGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l0pinhjp