si:ch211-215l11.5

Ensembl ID:
ENSDARG00000013721
ZFIN ID:
ZDB-GENE-050309-17
Description:
im:6895556 [Source:RefSeq peptide;Acc:NP_001157278]
Human Orthologue:
G6PC
Human Description:
glucose-6-phosphatase, catalytic subunit [Source:HGNC Symbol;Acc:4056]
Mouse Orthologue:
G6pc
Mouse Description:
glucose-6-phosphatase, catalytic Gene [Source:MGI Symbol;Acc:MGI:95607]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27878 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017
sa22025 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091868 Missense 149 355 3 5
ENSDART00000130087 Essential Splice Site 138 352 None 6

The following transcripts of ENSDARG00000013721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6727972)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6010892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCATCCTCGCCATAATGCTTAGCAAAGGGAAGAAATCAACATCCAAT[A/G]GCCTGTAAGTCAATCCCTATCATACAATAAAGTCATTTGACATCACCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091868 Nonsense 157 355 4 5
ENSDART00000130087 Nonsense 154 352 5 6

The following transcripts of ENSDARG00000013721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 6728104)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6011024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCATTCATACTGTTTGTTTTCTTCTCAGATACTTGCGTGGCTCACTTT[G/A]GACACTCTTCTGGACGGTCCAGATCTGTGTTTGTCTCTCTCGGGTCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link