lass2

Ensembl ID:
ENSDARG00000013704
ZFIN ID:
ZDB-GENE-020808-2
Description:
LAG1 homolog, ceramide synthase 2 [Source:RefSeq peptide;Acc:NP_705957]
Human Orthologue:
LASS2
Human Description:
LAG1 homolog, ceramide synthase 2 [Source:HGNC Symbol;Acc:14076]
Mouse Orthologue:
Lass2
Mouse Description:
LAG1 homolog, ceramide synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1924143]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4078 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025385 Nonsense 303 383 10 11
ENSDART00000115205 Nonsense 303 383 9 10
Genomic Location:
Chromosome 19 (position 9399961)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACCTGGGTGTATCCGGTGACTGTTTATCCTCCGTTTTTTGGGTATTA[C/A]TTCTTCAACGGGCTGCTGTTTGTRCTGCAGTGTCTGCACATCTTCTGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hnnkbmgf