si:ch211-212d10.4

Ensembl ID:
ENSDARG00000013687
ZFIN ID:
ZDB-GENE-050208-436
Description:
Novel protein similar to vertebrate cartilage intermediate layer protein, nucleotide pyrophosphohydr
Human Orthologue:
CILP2
Human Description:
cartilage intermediate layer protein 2 [Source:HGNC Symbol;Acc:24213]
Mouse Orthologue:
Cilp2
Mouse Description:
cartilage intermediate layer protein 2 Gene [Source:MGI Symbol;Acc:MGI:1915959]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24147 Nonsense Available for shipment Available now
sa43811 Nonsense Mutation detected in F1 DNA During 2017
sa37492 Nonsense Mutation detected in F1 DNA During 2017
sa15010 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061430 Nonsense 213 1255 5 10
ENSDART00000132684 Nonsense 99 1141 2 6
Genomic Location (Zv9):
Chromosome 22 (position 18705011)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18455946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCACTGAAATCTTGACTTAATAGCCATGTGGAGCCAGTGGGGTTCATG[G/A]GGAGCTTGCTCAGTAACCTGTGGAAAGGGACGGAGGACAAGACGTAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061430 Nonsense 424 1255 8 10
ENSDART00000132684 Nonsense 310 1141 5 6
Genomic Location (Zv9):
Chromosome 22 (position 18705891)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18456826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACAATTTTCAAATATGACGAAGATTTGATATTGCGAGACCTCAAACCA[G/T]AGCAGTCTGGGCAATATCACTGCAAAGCAACTAGTCTGACAGGCAGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061430 Nonsense 982 1255 9 10
ENSDART00000132684 Nonsense 868 1141 6 6
Genomic Location (Zv9):
Chromosome 22 (position 18708727)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18459662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTTGATGCCAACCACTTTCGTTTTTTCCGTGTTGAAAAAGATAAATA[T/A]GAATACAATGTGGTACCCTTTCAGGAAAGTGACCTTACATCTTGGACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061430 Nonsense 1114 1255 9 10
ENSDART00000132684 Nonsense 1000 1141 6 6
Genomic Location (Zv9):
Chromosome 22 (position 18709121)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18460056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATTAACAGTCTCCTGCAAGAGTATCWGATAAAGCATCCCCCTGTTCTT[C/T]AGAATAATGAGTCACATGCATTCAATATGTTAGCACCCGTTGATCCCCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
  • Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)
  • Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link