NAPB (2 of 2)

Ensembl ID:
ENSDARG00000013669
Description:
N-ethylmaleimide-sensitive factor attachment protein, beta [Source:HGNC Symbol;Acc:15751]
Human Orthologue:
NAPB
Human Description:
N-ethylmaleimide-sensitive factor attachment protein, beta [Source:HGNC Symbol;Acc:15751]
Mouse Orthologue:
Napb
Mouse Description:
N-ethylmaleimide sensitive fusion protein attachment protein beta Gene [Source:MGI Symbol;Acc:MGI:10

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42850 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022233 Nonsense 22 246 1 10
Genomic Location (Zv9):
Chromosome 17 (position 4085288)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 4160121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAAGAGAAGGAGGCCATGCAGCTGATGGCGGAGGCGGACAAAAAAGTC[A/T]AATCCTCGGGTTCATTTCTCGGAGGGATGTTCGGGTGAGACAGCGATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link