tbck

Ensembl ID:
ENSDARG00000013667
ZFIN ID:
ZDB-GENE-070112-1062
Description:
TBC domain-containing protein kinase-like protein [Source:RefSeq peptide;Acc:NP_001074106]
Human Orthologue:
TBCK
Human Description:
TBC1 domain containing kinase [Source:HGNC Symbol;Acc:28261]
Mouse Orthologue:
Tbck
Mouse Description:
TBC1 domain containing kinase Gene [Source:MGI Symbol;Acc:MGI:2445052]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5942 Nonsense Mutation detected in F1 DNA During 2014
sa15794 Nonsense Available for shipment Available now
sa19585 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043309 Nonsense 74 893 2 25
ENSDART00000053028 Nonsense 74 289 3 10
ENSDART00000125099 Nonsense 74 390 3 12
Genomic Location:
Chromosome 1 (position 50792012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATCCTCTTGTTGTTTTGCAGAGCGCCTGGTTATTGTAGCTGAGCACTA[T/A]GAAAAAAGCTTGAAGGACCTTTTGAAGCAGCGGAAACCTGTCAGGTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043309 Nonsense 557 893 17 25
ENSDART00000053028 None None 289 None 10
ENSDART00000125099 None None 390 None 12
Genomic Location:
Chromosome 1 (position 50764811)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGATGTTTTTGCTTCAGGCTTGGATTCRCTTTGTGCACCTTTCCTTTA[T/G]TTAAATTTCAACAATGAAGGYAAGACTYCTGGCCCCCAAAAAAGCCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043309 Nonsense 712 893 22 25
ENSDART00000053028 None None 289 None 10
ENSDART00000125099 None None 390 None 12
Genomic Location:
Chromosome 1 (position 50728193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAATCCATCAACCTTTTTTGCTGGACTCCTAAAAGTGCCACTTACCGC[C/T]AGCATGCCCAGCCAAACAAACCTCCCAGCGAGAGCAACAGCTTCGGCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pf4zda28