LOC560607

Ensembl ID:
ENSDARG00000013649
Human Orthologue:
CASR
Human Description:
calcium-sensing receptor [Source:HGNC Symbol;Acc:1514]
Mouse Orthologue:
Casr
Mouse Description:
calcium-sensing receptor Gene [Source:MGI Symbol;Acc:MGI:1351351]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20589 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010934 Nonsense 137 944 2 6
Genomic Location:
Chromosome 5 (position 71194751)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTCACTGAATCTGGACGAGTTCTGTAACTGCACAGGGAACATCCCAT[C/A]AACCATTGCAGTGGTCGGGGCTTCTGGATCTGCAGTGTCTACTGCCGTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Calcium levels: Common variants in the calcium-sensing receptor gene are associated with total serum calcium levels. (View Study)
  • Calcium levels: Genome-wide meta-analysis for serum calcium identifies significantly associated SNPs near the calcium-sensing receptor (CASR) gene. (View Study)
  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)
  • Phosphorus levels: Common genetic variants associate with serum phosphorus concentration. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0kokfm17