si:ch211-273a21.1

Ensembl ID:
ENSDARG00000013647
ZFIN ID:
ZDB-GENE-090312-57
Human Orthologues:
CNTN1, CNTN2, CNTN5
Human Descriptions:
contactin 1 [Source:HGNC Symbol;Acc:2171]
contactin 2 (axonal) [Source:HGNC Symbol;Acc:2172]
contactin 5 [Source:HGNC Symbol;Acc:2175]
Mouse Orthologues:
Cntn1, Cntn2, Cntn5
Mouse Descriptions:
contactin 1 Gene [Source:MGI Symbol;Acc:MGI:105980]
contactin 2 Gene [Source:MGI Symbol;Acc:MGI:104518]
contactin 5 Gene [Source:MGI Symbol;Acc:MGI:3042287]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1947 Nonsense Available for shipment Available now
sa1280 Nonsense Available for shipment Available now
sa32427 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104954 Nonsense 110 966 3 22
ENSDART00000131232 Nonsense 110 929 3 19
Genomic Location (Zv9):
Chromosome 23 (position 11215423)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11174225
KASP Assay ID:
554-1935.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTGCATGGGTCTTTAAYGAGTACCCTTACTTTGTTCAGCAAGACAAT[C/T]GACGCTTTGTCTCTCAGGAGACGGGAAACCTTTACATCGCCAAAGTGGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104954 Nonsense 486 966 10 22
ENSDART00000131232 Nonsense 486 929 10 19
Genomic Location (Zv9):
Chromosome 23 (position 11160230)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11119032
KASP Assay ID:
554-1195.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCTCGTTCTCTTGGGCCTTCAATGGGCAGCTGCTCAGTAAACTCGAC[C/T]AACATTATGAGCATGTGGGTGGGGTAAGTCAGACTTTACTACGTCTATAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa32427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104954 Nonsense 761 966 16 22
ENSDART00000131232 Nonsense 760 929 16 19
Genomic Location (Zv9):
Chromosome 23 (position 11130384)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11089186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGCGTGTGGGCCAGAAGCATCTCCGCCACTGAAATTGAAGTGAGCTG[G/A]CACATCCTCAGCGTTTCAACAGAAAGAGTGTTGGGCTATGAGGTGCGTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link