pbx3b

Ensembl ID:
ENSDARG00000013615
ZFIN ID:
ZDB-GENE-000405-3
Description:
pre-B-cell leukemia transcription factor 3b isoform 1 [Source:RefSeq peptide;Acc:NP_001091713]
Human Orthologue:
PBX3
Human Description:
pre-B-cell leukemia homeobox 3 [Source:HGNC Symbol;Acc:8634]
Mouse Orthologue:
Pbx3
Mouse Description:
pre B-cell leukemia transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:97496]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2431 Nonsense F2 line generated During 2017
sa8808 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41256 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41255 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2431
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006685 Nonsense 98 261 2 5
ENSDART00000040126 Nonsense 98 297 2 7
ENSDART00000048994 Nonsense 106 238 4 10
ENSDART00000098822 Nonsense 113 276 4 8
ENSDART00000105204 Nonsense 113 312 4 10
ENSDART00000140420 Nonsense 98 287 2 6

The following transcripts of ENSDARG00000013615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 34773418)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33850919
GRCz10 8 33943631
KASP Assay ID:
554-2889.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGGCATGTAATGAGTTCACTACCCACGTAATGAACCTGTTGAGGGAA[C/T]AGTCTCGCACACGGCCCATCTCGCCCAAAGAGATTGAACGCATGGTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006685 Essential Splice Site 191 261 3 5
ENSDART00000040126 Essential Splice Site 191 297 3 7
ENSDART00000048994 Essential Splice Site 200 238 5 10
ENSDART00000098822 Essential Splice Site 206 276 5 8
ENSDART00000105204 Essential Splice Site 206 312 5 10
ENSDART00000140420 Essential Splice Site 191 287 3 6

The following transcripts of ENSDARG00000013615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 34772070)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33942283
KASP Assay ID:
2260-0861.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGCCAAAGAGGAGCTGGCTAAGAAGTGCAGCATAACAGTATCCCAG[G/A]TGAGACCACACCCCTTTTACAGCAGNNCACATGCCCAGTTTGTTGGAYAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006685 Essential Splice Site 247 261 None 5
ENSDART00000040126 Essential Splice Site 257 297 None 7
ENSDART00000048994 Essential Splice Site None 238 None 10
ENSDART00000098822 Essential Splice Site 262 276 None 8
ENSDART00000105204 Essential Splice Site 272 312 None 10
ENSDART00000140420 Essential Splice Site 247 287 None 6

The following transcripts of ENSDARG00000013615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 34764688)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33934901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCCGTCCAGAATAGTCAGACCAACTCACCCACCACACCCAACTCCGG[T/G]AAGCTTGCACCATTCCCGGACGAGCCCCCTAAAAACCAACCAGCCATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006685   None 261 5 5
ENSDART00000040126   None 297 None 7
ENSDART00000048994 Essential Splice Site None 238 None 10
ENSDART00000098822 Essential Splice Site None 276 None 8
ENSDART00000105204 Essential Splice Site None 312 None 10
ENSDART00000140420   None 287 6 6

The following transcripts of ENSDARG00000013615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 34761170)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 33931383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGATGTCCTGGGGGGGAATCCCATGTATAGTCCACATGGCTTGAATG[T/A]AAGTATAGTCTCAGTCAGCCTTGAAGAGGCATTAATAATAATAATACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link