sema3gb

Ensembl ID:
ENSDARG00000013607
ZFIN ID:
ZDB-GENE-050513-4
Description:
semaphorin 3gb [Source:RefSeq peptide;Acc:NP_001014824]
Human Orthologue:
SEMA3F
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F [Source:HGNC
Mouse Orthologue:
Sema3f
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F Gene [Source:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34391 Nonsense Mutation detected in F1 DNA During 2017
sa21283 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026316 Nonsense 156 746 5 17
ENSDART00000129378 Nonsense 156 745 5 17
Genomic Location (Zv9):
Chromosome 8 (position 24396418)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23522236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGATTATGTGTAGGAATACCTCTTCCGGCTGGTTCCTGGTTA[T/A]GTGGACTCTGGAAAAGGAAAGTCTCCTTATGATCCCCGGCAGGAGAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026316 Nonsense 408 746 11 17
ENSDART00000129378 Nonsense 408 745 11 17
Genomic Location (Zv9):
Chromosome 8 (position 24400714)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23526532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCTCAGACGAGGCTGTAAACTTTGTCCGTGCCCATCCGCTGATGTAC[C/T]AACCTATATATCCCATACACAAGCGCCCCCTGGTGGTCAGGACTGGAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link