tnfb

Ensembl ID:
ENSDARG00000013598
ZFIN ID:
ZDB-GENE-050601-2
Description:
tumor necrosis factor (TNF superfamily, member 2) [Source:RefSeq peptide;Acc:NP_001019618]
Human Orthologues:
LTA, TNF
Human Descriptions:
lymphotoxin alpha (TNF superfamily, member 1) [Source:HGNC Symbol;Acc:6709]
tumor necrosis factor [Source:HGNC Symbol;Acc:11892]
Mouse Orthologues:
Lta, Tnf
Mouse Descriptions:
lymphotoxin A Gene [Source:MGI Symbol;Acc:MGI:104797]
tumor necrosis factor Gene [Source:MGI Symbol;Acc:MGI:104798]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22693 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22694 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017569 Essential Splice Site 60 242 1 4
Genomic Location:
Chromosome 15 (position 33996070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGGCCTCTGCGTTGTGGCTGCATTTTTCTTCACCTGGCATGTGATG[G/A]TAAGACTGAAATTTCATTGAGGGATGATCATTGGAATAATGAAACATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017569 Splice Site, Nonsense 82 242 2 4
Genomic Location:
Chromosome 15 (position 33996221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCAGAAACCCAACAGAGAACATCTAAAACAACAAATCACCACACCTT[C/A]AGGTTAATAACATTCCCAGTATTCCATCTTGTACTTTTGTTTTGCTTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • AIDS progression: Genomewide association study of an AIDS-nonprogression cohort emphasizes the role played by HLA genes (ANRS Genomewide Association Study 02). (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Neonatal lupus: Identification of candidate loci at 6p21 and 21q22 in a genome-wide association study of cardiac manifestations of neonatal lupus. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qp1uu5hv