brd1

Ensembl ID:
ENSDARG00000013596
ZFIN ID:
ZDB-GENE-041008-168
Description:
Novel protein similar to vertebrate bromodomain containing 1 (BRD1) [Source:UniProtKB/TrEMBL;Acc:Q5R
Human Orthologue:
BRD1
Human Description:
bromodomain containing 1 [Source:HGNC Symbol;Acc:1102]
Mouse Orthologue:
Brd1
Mouse Description:
bromodomain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1924161]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33480 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013083 Nonsense 304 1142 1 12
ENSDART00000145083 Nonsense 304 1142 2 13
Genomic Location (Zv9):
Chromosome 4 (position 26429042)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27143363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACGGTTTTTATAGAGCCTATTGATGGTGTCTCAAACATTCCCCCTGCT[C/T]GATGGAAACTTACTTGCTACCTCTGTAAAGAAAAAGGTGTTGGAGCTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link