ck2a2b

Ensembl ID:
ENSDARG00000013582
ZFIN ID:
ZDB-GENE-090406-4
Human Orthologue:
CSNK2A2
Human Description:
casein kinase 2, alpha prime polypeptide [Source:HGNC Symbol;Acc:2459]
Mouse Orthologue:
Csnk2a2
Mouse Description:
casein kinase 2, alpha prime polypeptide Gene [Source:MGI Symbol;Acc:MGI:88547]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12298 Nonsense Available for shipment Available now
sa12273 Nonsense Available for shipment Available now
sa44253 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045488 Nonsense 283 350 10 12
ENSDART00000045488 Nonsense 283 350 10 12
Genomic Location:
Chromosome 25 (position 14075599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWWTTAAATTTTTCCTKTCGTGTCCCCACAGGCAGACAMGGAAGCGCTGG[G/T]AACAATTTGTGCAGACGGAGAACCAGCATTTGGTGAGTCCAGAGGCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045488 Nonsense 283 350 10 12
ENSDART00000045488 Nonsense 283 350 10 12
Genomic Location:
Chromosome 25 (position 14075599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWWTTAAATTTTTCCTKTCGTGTCCCCACAGGCAGACAMGGAAGCGCTGG[G/T]AACAATTTGTGCAGACGGAGAACCAGCATTTGGTGAGTCCAGAGGCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045488 Essential Splice Site None 350 11 12
Genomic Location:
Chromosome 25 (position 14075307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACGGCACTATAGTGTCAAGCGGAACCAACACACCCCGATGAGAGCAG[G/A]TATCAATCACTGATCAGTCAATATTCACATATGTGCTTTTAACTCTTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link