ck2a2b

Ensembl ID:
ENSDARG00000013582
ZFIN ID:
ZDB-GENE-090406-4
Human Orthologue:
CSNK2A2
Human Description:
casein kinase 2, alpha prime polypeptide [Source:HGNC Symbol;Acc:2459]
Mouse Orthologue:
Csnk2a2
Mouse Description:
casein kinase 2, alpha prime polypeptide Gene [Source:MGI Symbol;Acc:MGI:88547]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12298 Nonsense Available for shipment Available now
sa12273 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045488 Nonsense 283 350 10 12
ENSDART00000045488 Nonsense 283 350 10 12
Genomic Location:
Chromosome 25 (position 14075599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWWTTAAATTTTTCCTKTCGTGTCCCCACAGGCAGACAMGGAAGCGCTGG[G/T]AACAATTTGTGCAGACGGAGAACCAGCATTTGGTGAGTCCAGAGGCTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045488 Nonsense 283 350 10 12
ENSDART00000045488 Nonsense 283 350 10 12
Genomic Location:
Chromosome 25 (position 14075599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWWTTAAATTTTTCCTKTCGTGTCCCCACAGGCAGACAMGGAAGCGCTGG[G/T]AACAATTTGTGCAGACGGAGAACCAGCATTTGGTGAGTCCAGAGGCTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/87sv9bp4