gadd45bb

Ensembl ID:
ENSDARG00000013576
ZFIN ID:
ZDB-GENE-050223-1
Description:
growth arrest and DNA-damage-inducible, beta b [Source:RefSeq peptide;Acc:NP_001012386]
Human Orthologue:
GADD45B
Human Description:
growth arrest and DNA-damage-inducible, beta [Source:HGNC Symbol;Acc:4096]
Mouse Orthologue:
Gadd45b
Mouse Description:
growth arrest and DNA-damage-inducible 45 beta Gene [Source:MGI Symbol;Acc:MGI:107776]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31288 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005382 Essential Splice Site 49 158 None 4

The following transcripts of ENSDARG00000013576 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 36661186)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36957896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTGTCTGACAGTTGGAGTCTACGAGTCTGCACAACTCATGAATGTG[T/G]AAGTATTTTATTCATTTAAACATAACATTCAGCGCTTTGTACTTGACCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link