rfx2

Ensembl ID:
ENSDARG00000013575
ZFIN ID:
ZDB-GENE-050227-4
Description:
DNA-binding protein RFX2 [Source:UniProtKB/Swiss-Prot;Acc:Q5EAP5]
Human Orthologue:
RFX2
Human Description:
regulatory factor X, 2 (influences HLA class II expression) [Source:HGNC Symbol;Acc:9983]
Mouse Orthologue:
Rfx2
Mouse Description:
regulatory factor X, 2 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:106583]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14019 Nonsense Available for shipment Available now
sa31644 Nonsense Mutation detected in F1 DNA During 2016
sa21260 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029939 Nonsense 113 734 5 18
ENSDART00000122943 Nonsense 113 738 4 18
ENSDART00000132218 Nonsense 83 189 4 6
ENSDART00000133141 Nonsense 83 234 5 7
ENSDART00000147634 Nonsense 83 170 4 5
Genomic Location (Zv9):
Chromosome 8 (position 20638559)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20068456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTATAAYCCAGAGTCCCAGCTATATGGTCAGGGCAGTGGAAGTGCCTA[T/A]TTCGACTCTCAGGCGGGTGGTGCTCAGGTAACCACAGTCGTCTCTTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029939 Nonsense 403 734 11 18
ENSDART00000122943 Nonsense 403 738 10 18
ENSDART00000132218   None 189 None 6
ENSDART00000133141   None 234 None 7
ENSDART00000147634   None 170 None 5
Genomic Location (Zv9):
Chromosome 8 (position 20622040)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20051937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTGGATGTTGTGATGAACCTGCAATTTCATCTCATAGAGAAGCTGTG[G/A]CAGACCTTTTGGCATTCAACAGCGCCCTCTAGTGACGGAGCCACTACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029939   None 734 18 18
ENSDART00000122943 Nonsense 727 738 18 18
ENSDART00000132218   None 189 None 6
ENSDART00000133141   None 234 None 7
ENSDART00000147634   None 170 None 5
Genomic Location (Zv9):
Chromosome 8 (position 20612354)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20042251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGTGTGTCTCCTTTAGGTTTTCTGCGACTGTGAAGCAAGAATGTGCTG[G/A]TTTGGTGGCGTGTGGTTTATTTTTCATGTGCCATAGTCTTCTTTCAGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link