pgm1

Ensembl ID:
ENSDARG00000013561
ZFIN ID:
ZDB-GENE-040426-1245
Description:
phosphoglucomutase-1 [Source:RefSeq peptide;Acc:NP_957319]
Human Orthologues:
PGM1, PGM5
Human Descriptions:
phosphoglucomutase 1 [Source:HGNC Symbol;Acc:8905]
phosphoglucomutase 5 [Source:HGNC Symbol;Acc:8908]
Mouse Orthologues:
Pgm2, Pgm5
Mouse Descriptions:
phosphoglucomutase 2 Gene [Source:MGI Symbol;Acc:MGI:97565]
phosphoglucomutase 5 Gene [Source:MGI Symbol;Acc:MGI:1925668]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31516 Essential Splice Site Available for shipment Available now
sa15441 Essential Splice Site Available for shipment Available now
sa20723 Essential Splice Site Available for shipment Available now
sa31515 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006417 Essential Splice Site 82 561 1 11
Genomic Location (Zv9):
Chromosome 6 (position 31717036)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32037952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGAAAGACGCGATTCAGCTCATCATCCAGATTGCTGCTGCTAATGGG[G/A]TTAGTATGGGCCCAATTTAACGAGTAGCTTAAACTTAAAACAAACGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006417 Essential Splice Site 82 561 1 11
Genomic Location (Zv9):
Chromosome 6 (position 31717035)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32037951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGAAAGACGCGATTCAGCTCATCATCCAGATTGCTGCTGCTAATGGGG[T/C]TAGTATGGGCCCAATTTAACGAGTRGCTTRAACTTAAAACAAACGTCTTK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006417 Essential Splice Site 227 561 4 11
Genomic Location (Zv9):
Chromosome 6 (position 31712244)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32033160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCAGGACCCAATCATATCAATGTGCGACTTGATGCAATGCATGGAGG[T/C]AAGAGCTCAATTCCTGCCAGACAAAAATAAAGTTCAGTGTTTCAGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006417 Essential Splice Site 342 561 6 11
Genomic Location (Zv9):
Chromosome 6 (position 31710493)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32031409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTAAAGGGTCTGGCTCGCAGTATGCCCACCAGCGGGGCTTTGGACAAG[T/A]ATGAGCATCTAAGCATACTTACAATTTGTGATTTGGCTCTATATTTGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Alcohol consumption: Genome-wide association study identifies two loci strongly affecting transferrin glycosylation. (View Study)
  • Bipolar disorder: A genome-wide association study of seasonal pattern mania identifies NF1A as a possible susceptibility gene for bipolar disorder. (View Study)
  • Type 1 diabetes: Genome-wide association study and meta-analysis find that over 40 loci affect risk of type 1 diabetes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link