LOC794371

Ensembl ID:
ENSDARG00000013552
Human Orthologue:
SLC16A5
Human Description:
solute carrier family 16, member 5 (monocarboxylic acid transporter 6) [Source:HGNC Symbol;Acc:10926
Mouse Orthologue:
Slc16a5
Mouse Description:
solute carrier family 16 (monocarboxylic acid transporters), member 5 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa937 Nonsense F2 line generated During 2016
sa33301 Nonsense Mutation detected in F1 DNA During 2016
sa33302 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa937
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074436 Nonsense 87 547 1 4
Genomic Location (Zv9):
Chromosome 3 (position 49724998)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44419418
KASP Assay ID:
554-0842.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGATGGAGGCTGGGGTTGGGTGGTCGTTGCTGCCACAATTCTGGTCT[T/G]RGCCATGACTCTGGCTTTCCCRTCCTGCATCGGGATATTTTACACAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33301
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074436 Nonsense 246 547 3 4
Genomic Location (Zv9):
Chromosome 3 (position 49733903)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44428323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGGCGGGGTAGTTTTCTGGTACTCGGAGGGGTTCTGTTGAACTGTTG[T/A]GTTTGTGGCGCAGTGATGCGCCCCCTTGCAGCCAAACCAAAAACGGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074436 Nonsense 503 547 4 4
Genomic Location (Zv9):
Chromosome 3 (position 49738490)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44432910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTCTCTTCATCATGCTGTCCTTCTACTGGCTGGACAGACGAAGAGAC[C/T]GAGAGCAGGTCAAGAGTTCTTCAGCTCATCAAGATCCTCATTCCCTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link