ikzf1

Ensembl ID:
ENSDARG00000013539
ZFIN ID:
ZDB-GENE-980526-304
Description:
DNA-binding protein Ikaros [Source:RefSeq peptide;Acc:NP_571061]
Human Orthologue:
IKZF1
Human Description:
IKAROS family zinc finger 1 (Ikaros) [Source:HGNC Symbol;Acc:13176]
Mouse Orthologue:
Ikzf1
Mouse Description:
IKAROS family zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:1342540]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11269 Nonsense Available for shipment Available now
sa22256 Nonsense Mutation detected in F1 DNA During 2014
sa22255 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016430 Nonsense 179 537 6 9
ENSDART00000042377 None None 294 None 4
ENSDART00000046079 Nonsense 76 392 4 6
ENSDART00000050481 Nonsense 76 434 4 7
ENSDART00000079724 Nonsense 168 526 5 8
Genomic Location:
Chromosome 13 (position 15919958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGTGCAATCAATGTGGTGCTTCATTCACTCAGAAGGGTAACCTGCTC[C/T]GACACATCAAACTTCACTCTGGCGAGAAACCTTTCAAATGTCACCTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016430 Nonsense 294 537 8 9
ENSDART00000042377 None None 294 None 4
ENSDART00000046079 None None 392 None 6
ENSDART00000050481 Nonsense 191 434 6 7
ENSDART00000079724 Nonsense 283 526 7 8
Genomic Location:
Chromosome 13 (position 15916302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTAGACAGGATAGCTAACAATGTAGCTAAGCGTAAGAGCTCTATGCCA[C/T]AGAGGTTTGTGGGTAAGAGTTGAAGTTTGCTTTCATTGTGCAGCAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016430 Nonsense 330 537 9 9
ENSDART00000042377 Nonsense 87 294 4 4
ENSDART00000046079 Nonsense 185 392 6 6
ENSDART00000050481 Nonsense 227 434 7 7
ENSDART00000079724 Nonsense 319 526 8 8
Genomic Location:
Chromosome 13 (position 15913086)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATGCAGCCCCATGTGATTGATCAGGCCATCAACAGTGCAATTAGCTA[T/A]CTGGGTGCAGAGTCCTTGCGGCCTCTGGTTCAGACCTCTCCTGGGTCCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n3qrzi7v