hoxb4a

Ensembl ID:
ENSDARG00000013533
ZFIN ID:
ZDB-GENE-990415-105
Description:
Homeobox protein Hox-B4a [Source:UniProtKB/Swiss-Prot;Acc:P22574]
Human Orthologue:
HOXB4
Human Description:
homeobox B4 [Source:HGNC Symbol;Acc:5115]
Mouse Orthologue:
Hoxb4
Mouse Description:
homeobox B4 Gene [Source:MGI Symbol;Acc:MGI:96185]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa997 Nonsense Available for shipment Available now
sa8115 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012470 Nonsense 175 246 2 2
Genomic Location:
Chromosome 3 (position 24014513)
KASP Assay ID:
554-0901.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAGGCAGCAAGTCCTGGAATTGGAGAAAGAGTTCCATTACAACCGCTA[T/A]CTGACCCGCAGAAGAAGGGTGGAAATCGCCCATACACTATGCCTATCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012470 Nonsense 207 246 2 2
Genomic Location:
Chromosome 3 (position 24014607)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCTGAACGACAAATTAAGATTTGGTTTCAGAACCGGCGCATGAAGTGG[A/T]ARAAGGACCATAAGCTTCCGAACACCAAAATACGCAGTAACTCTGCAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bjt8e3kx